(Stroke. 1996;27:2304-2311.)
© 1996 American Heart Association, Inc.
Articles |
the Department of Neurology, University of Southern California School of Medicine (Los Angeles) (N.D.T., V.L.Y.W., S.S.S., M.F.) and Amgen Corporation, Thousand Oaks, Calif (J.V.B.).
Correspondence to Mark Fisher, MD, Department of Neurology, University of Southern California School of Medicine, 1333 San Pablo St, MCH246, Los Angeles, CA 90033. E-mail mjfisher@hsc.usc.edu.
| Abstract |
|---|
|
|
|---|
Methods Bovine brain capillary endothelial cells were grown in a blood-brain barrier model in which endothelial cells form capillary-like structures. In situ hybridization and polymerase chain reaction (PCR) were used to examine thrombomodulin expression. Endothelial cells were then cocultured with astrocytes. We examined both coculture and monoculture preparations for
-glutamyl transpeptidase (GGTP), a marker of the blood-brain barrier. We then used quantitative-competitive PCR to compare thrombomodulin expression in endothelial monocultures and astrocyte-endothelial cocultures after 1 and 7 days of culture.
Results Both in situ hybridization and PCR studies demonstrated thrombomodulin mRNA expression by endothelial cells. During 1 week of astrocyte-endothelial coculture, there was (1) progressive association of astrocytes with capillary-like structures and (2) expression of GGTP; endothelial monocultures did not express GGTP. There was no significant difference in thrombomodulin mRNA expression for cocultures versus monocultures after 1 day. After 1 week, however, astrocyte-endothelial cocultures had markedly decreased thrombomodulin mRNA compared with monocultures (9±2 versus 189±62 pg/mL; P<.025). This thrombomodulin mRNA decrease thus occurred when elements of the blood-brain barrier phenotype were demonstrable, ie, when astrocyte association with capillary-like structures was maximal and when GGTP was expressed in cocultures.
Conclusions These findings indicate astrocyte regulation of thrombomodulin mRNA expression in vitro and suggest an important role for the blood-brain barrier in the regulation of thrombomodulin.
Key Words: astrocyte blood-brain barrier endothelium thrombomodulin
| Introduction |
|---|
|
|
|---|
Animals pretreated with purified or recombinant TM are protected against thromboembolism.5 6 Activated protein C provides protection against procoagulant and lethal effects in a sepsis model.7 Resistance to the effects of activated protein C is closely linked to venous thrombosis in humans.8 TM thus offers crucial protection against a variety of thrombotic events. Although the actions of TM are well defined, little is known of the mechanisms that govern endothelial expression of TM in the brain.
Endothelial cells lining capillaries of the CNS are unique in that they constitute a central component of the BBB, a physiological structure separating the vascular bed from the CNS. A primary role of the BBB is to control selective transport of essential nutrients, hormones, and proteins to the CNS.9 Endothelial cells at the BBB are intimately associated with several cell types, including astrocytes, whose processes ensheathe capillaries and form the glia limitans.10 11 Astrocyte effects on brain endothelial cells include tight junction formation,12 13 increased electrical resistance,14 15 and induction of GGTP.16 Astrocytes also regulate expression of the LDL receptor by brain capillary endothelial cells.17
Thrombosis is of paramount importance in the pathophysiology of ischemic stroke.18 Recent work has begun to define the role of microcirculatory hemostasis factors in large-vessel infarction models. Tissue plasminogen activator has been identified at the BBB in rats.19 In a diabetic model, downregulation of brain microvascular tissue plasminogen activator mRNA and protein is associated with increased infarct size after reversible MCA occlusion.20 Chronic infusion of nicotine depletes brain microvascular tissue plasminogen activator protein and is also associated with increased infarct size after MCA occlusion.21 In a primate MCA occlusion model, microcirculatory deposition of fibrin is partially mediated by tissue factor.22 The role of TM in stroke models has yet to be defined. However, in a coronary artery occlusion model, blockade of activated protein C produces impaired cardiac outcome.23
A number of investigators have studied TM expression in the brain using immunocytochemistry.24 25 26 27 28 These investigations, while yielding somewhat contradictory findings, indicate limited expression of TM protein in the brain compared with other organs. The restricted expression of brain TM is unexplained, and the relationship between TM expression and the BBB has not been delineated. In the present study, we used a BBB model to test the hypothesis that astrocytes regulate brain TM mRNA expression. Tight junction formation and extensive astrocyteendothelial cell interactions have been demonstrated in this BBB model.29
| Materials and Methods |
|---|
|
|
|---|
|
Neonatal mouse astrocytes were isolated according to the method of McCarthy and DeVellis,31 performed within institutional guidelines. Briefly, cerebral hemispheres were removed from 1- to 2-day-old Swiss-Webster pups, cleaned of meninges and choroid plexus, and serially sieved through 230- and 140-µm meshes. The filtrate was centrifuged at 200g for 5 minutes at room temperature and resuspended in DMEM supplemented with 10% fetal bovine serum (Hyclone Labs), 100 U/mL penicillin, 100 µg/mL streptomycin, and 2 mmol/L L-glutamine. Cells were plated at a density of 30 cm2 per brain and maintained on DMEM with 10% fetal bovine serum in a humidified 5% CO2-95% air incubator at 37°C. At confluence, oligodendroglia were removed by orbital shaking at 37°C. Astrocytes were characterized by >99% immunoreactivity for GFAP. Astrocytes used for these experiments were taken from primary cultures for establishment of astrocyteendothelial cell cocultures. Mouse liver cells (CCL 9.1, ATCC) were maintained under conditions similar to astrocytes.
Immunocytochemistry
Ethanol-fixed frozen slides were rehydrated with PBS (pH 7.4), incubated with 0.3% H2O2 for 5 minutes, and washed with PBS. After a 15-minute incubation with 5% normal goat serum, the slides were incubated for 1 hour at room temperature with rabbit anti-bovine GFAP antibody (Dako) or rabbit anti-human von Willebrand factor antibody (Dako) at dilutions of 1:200 and 1:100, respectively. Control slides were incubated with PBS in place of the primary antibody. Slides were then incubated with biotinylated goat anti-rabbit immunoglobulin (Vector) at a 1:200 dilution for 30 minutes, avidin-biotin-peroxidase complex (Vector) for 15 minutes, and amino-ethylcarbazole for 10 minutes. Slides were counterstained in Mayer's hematoxylin and mounted in glycerol.
BBB Model
CS were prepared according to the method of Minakawa et al29 by first coating two 2x2-cm chamber Lab-Tek glass slides with 1% gelatin (Sigma) and then adding 4x104 endothelial cells per chamber in 1.0 mL DMEM with 2.5% equine serum. After incubation for 24 hours, the cells were washed with cold PBS; then 0.4 mL of a second collagen solution (pH 7.4) containing 80% type I collagen (Vitrogen, Celtrix Lab), 10% 10x minimum essential medium (GIBCO), and 10% 0.1 mol/L NaOH was added to the subconfluent monolayer, and excess Vitrogen solution was then aspirated. The slides were incubated for 10 minutes at 37°C, and culture medium (2.5% equine serumsupplemented DMEM) was then added to the slides. Endothelial cells elongated and formed CS within 24 hours. We established astrocyte-endothelial or liver-endothelial cocultures 3 days after the addition of the second collagen layer. Before the addition of astrocytes (4x104 cells per chamber) or liver cells (4x104 cells per chamber) to the capillary preparations, serum-supplemented media from astrocyte or liver preparations were removed, and the cells were treated with trypsin-EDTA and resuspended in endothelial culture medium. One day and 7 days after the addition of astrocytes, the cultures were fixed with 80% ethanol for 10 minutes and stained for GFAP to demonstrate association with CS. Cultures were monitored and photographed (x10 magnification) with an Olympus CK-2 phase-contrast microscope. The extent of CS formation for both monocultures and cocultures was determined by computer-assisted image analysis of photomicrographs using a Quantimet 970 Image Analysis System and the Quips software package (Cambridge Instruments Ltd). Photomicrographs from CS preparations were digitized using a video camera and stored as a 512x512-pixel matrix. The image was displayed as a combination of a gray image and a binary overlay, representing the detected region. A computer algorithm was used to calculate CS length. Digitized images of CS photomicrographs were calibrated against a digitized image of a 10-cm ruler. Quantifications were performed in duplicate.
Cells from coculture and monoculture preparations were treated with trypsin and counted. Cytopreps (Shannon Inc) were prepared from coculture and monoculture preparations. Slides were fixed in 80% ethanol and stained for von Willebrand factor and GFAP. The percentage of endothelial cells in culture was determined by the percentage of cells showing immunoreactivity for von Willebrand factor.
In Situ Hybridization
Frozen slides were fixed in 4% paraformaldehyde in PBS for 10 minutes, followed by three 10-minute washes in PBS. The cells were permeabilized for 5 minutes in 0.05% Triton X-100 in PBS, then deproteinized in 0.2 mol/L HCl for 10 minutes and 5.0 µg/mL proteinase K for 10 minutes. The slides were refixed in 4% paraformaldehyde for 5 minutes and stored at 4°C until use.
Synthetic sense (5' CTCGGCAACTACACGTGCATCTGCGAG 3') and antisense (5' GCCACCACCAGAGACAGGCTTGCAATGG 3') oligonucleotides (National Biosciences Inc) were chosen from bovine TM mRNA coding regions and used as probes for in situ hybridization. Probes were labeled with the Genius 3 Oligonucleotide 3'-End Labeling Kit (Boehringer Mannheim Biochemicals) according to the manufacturer's instructions. Briefly, 5 µmol/L of the probe was mixed with the reaction buffer (1 mol/L potassium cacodylate, 125 mmol/L Tris-HCl, 1.25 mg/mL BSA; pH 6.6), 5 mmol/L cobalt chloride, 0.2 mmol/L digoxigenin-11-dUTP, and 2.5 U/µL terminal transferase. The reaction was carried out at 37°C for 15 minutes and stopped by adding 1 µL glycogen solution (20 mg/mL) and 1 µL EDTA (200 mmol/L, pH 8.0) at 4°C. The labeled oligonucleotide was precipitated with 0.1 volume lithium chloride (4 mol/L) and 2.5 volume ethanol at -70°C for 30 minutes. The pellet was washed with 70% ethanol, dried, resuspended in 20 µL Tris-EDTA/SDS buffer and stored at -20°C. Hybridization was carried out in 4x SSC (3 mol/L sodium chloride, 0.3 mol/L sodium citrate), 50% formamide, 1x Denhardt's solution, 5% dextran sulfate, 0.5 mg/mL salmon sperm DNA, 0.25 mg/mL yeast tRNA, and 5 ng/µL of digoxigenin-labeled probe. Slides were incubated with the hybridization solution overnight in a humidified chamber at 42°C. Slides were then washed in 2x SSC for 1 hour, 1x SSC for 1 hour (both at 25°C), 0.5x SSC at 37°C for 30 minutes, and 0.5x SSC at 25°C for 30 minutes.
Immunologic detection of the digoxigenin-labeled probes was performed as indicated by the manufacturer. Briefly, slides were incubated overnight with antidigoxigenin-alkaline phosphatase conjugate antibody, diluted 1:500 in buffer 1 (100 mmol/L Tris-HCl, 150 mmol/L NaCl; pH 7.5). Slides were washed for 10 minutes three times in buffer 1, then rinsed briefly in buffer 3 (100 mmol/L Tris-HCl, 100 mmol/L NaCl, and 50 mmol/L MgCl2; pH 9.5). Slides were incubated in 0.45% nitro blue tetrazolium and 0.35% X-phosphate in buffer 3 for 1 to 5 hours. The color reaction was stopped with buffer 4 (10 mmol/L Tris-HCl, 1 mmol/L EDTA; pH 8.0).
GGTP Staining
Cocultures of astrocytes with CS, as well as endothelial cell and astrocyte monocultures, were stained histochemically for the presence of GGTP. The assay is based on the transfer of the glutamyl group from the substrate,
-glutamyl-4-methoxy-2-napthylamide, to glycylglycine catalyzed by GGTP, using fast blue BB as the chromagen.32 The slides were fixed with 80% ethanol, then incubated at 37°C for 90 minutes in a saline solution containing 0.25% DMSO, 1.2 mmol/L fast blue BB (Sigma), 0.125 mg/mL
-glutamyl-4-methoxy-2-napthylamide (Vega Biotechnologies), 20 mmol/L glycylglycine (Sigma), 2.5 mmol/L NaOH, and 25 mmol/L phosphate buffer. After incubation, the slides were washed in saline for 2 minutes, rinsed in 0.1 mol/L CuSO4 for 2 minutes, washed again in saline for 2 minutes, and mounted.
Polymerase Chain Reaction
Total RNA was isolated with the Glassmax DNA Spin Cartridge Isolation System (GIBCO BRL). Total RNA from each preparation was resuspended in 40 µL DEPC-treated water. cDNA was synthesized from equal volumes of total RNA in a total volume of 20 µL. RNA was incubated in 5 µL DEPC-treated water at 65°C for 3 minutes and quickly placed on ice. The RNA was then added to the transcription solution: 1.5 µmol/L oligo dT primers, 50 mmol/L Tris-HCl, 75 mmol/L KCl, 3 mmol/L MgCl2, 0.5 mmol/L dNTP, 1 U/µL RNase inhibitor, 13.3 U/µL avian myeloblastoma virus reverse transcriptase. The reaction was carried out at 42°C for 1 hour and terminated at 52°C for 40 minutes. The cDNA was stored at -20°C until use.
The PCR reaction mixture contained 0.2 to 1.0 µg cDNA, 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 0.1 mmol/L dNTP, 1.0 mmol/L MgCl2, 1.0 U Taq polymerase, and 0.5 µmol/L forward and reverse primers. The bovine TM primers (National Biosciences Inc) extending from bases 228 to 256 (forward primer, 5' CTCGGCAACTACACGTGCATCTGCGAG 3') and 907 to 935 (reverse primer, 5' GCCACCACCAGAGACAGGCTTGCAATGG 3') were chosen from well-conserved coding regions of the mRNA.33 ß-Actin primers (Stratagene; forward primer, 5' TGACGGGGTCACCCACACTGTGCCCATCTA 3'; reverse primer, 5' CTAGAAGCATTTGCGGTGGACGATGGAGGG 3') were used to amplify ß-actin mRNA as a housekeeping gene control. Amplification was carried out in a DNA Thermal Cycler (Perkin-Elmer Corp): initial denaturation at 94°C, with each cycle consisting of 1 minute denaturation at 94°C, 1 minute annealing at 54°C, and 2 minutes extension at 72°C. PCR products were visualized by electrophoresis on a 2% agarose gel and stained with ethidium bromide.
Quantitative competitive PCR tubes contained all the amplification reagents (described above), a constant amount of target TM cDNA from each preparation, and serial dilutions of known concentrations of a competitor TM cDNA template. The reaction mixture was coamplified as described above. The competitor cDNA template was prepared by site-directed mutagenesis.34 A single base change of A to G at bp 346 created a unique Sal I restriction site.
After coamplification, the PCR products were digested with Sal I: 10 µL PCR product, 1 U Sal I restriction enzyme, and 2 µL enzyme buffer incubated at 37°C for 2 hours. The digested competitor (591 bp) and target (707 bp) cDNAs were separated by electrophoresis on a 2% agarose gel and visualized by ethidium bromide staining and UV transillumination. Negatives were prepared with a Polaroid camera (Polaroid Corp) and scanned by optical densitometry (Hoefer Instruments). Density readings of the target cDNA were multiplied by 591/707 to correct for differences in molecular weight. The ratio of amplified target versus competitor cDNA optical densities was plotted as a function of competitor template concentration. The initial concentration of target cDNA was derived from the point at which the ratio of target and competitor cDNA optical density equaled 1 (Fig 2
). TM mRNA concentrations were adjusted to 1x105 endothelial cells, ie, dividing TM concentration by cell count; data are expressed as mean±SD. For some experiments, mRNA levels were determined by standard densitometric analysis of PCR products and subsequent calculations of relative abundance; the latter was determined by arbitrarily characterizing the larger of the two values (monoculture or coculture) as 100%. Statistical comparisons between groups were performed using unpaired Student's t tests and Pearson correlation coefficients. Differences were considered significant at P<.05.
|
| Results |
|---|
|
|
|---|
|
|
We added primary culture murine astrocytes to CS cultures 3 days after the addition of the second collagen matrix. The composition of cocultures (endothelial cells versus astrocytes) showed little change over time (Table
). After 7 days of coculture, nearly all of the astrocytes were associated with CS, with astrocytic processes completely enveloping the CS (Fig 5
). Thus, after 7 days, astrocyteendothelial cell interactions in coculture mimicked morphological features of the BBB.
|
|
We performed GGTP staining to further define astrocyteendothelial cell interactions in our model. We analyzed GGTP activity at 1 and 7 days after the addition of astrocytes to CS. GGTP activity was not detectable after 1 day of coculture (Fig 6
). After 7 days of coculture, there was GGTP activity present along the entire length of CS (Fig 6
). Endothelial cell monocultures did not exhibit detectable levels of GGTP. Thus, after 7 days of coculture, astrocytes induced further manifestations of the BBB.
|
We then used quantitative-competitive PCR to determine levels of TM mRNA in both endothelial monocultures and astrocyte-endothelial cocultures. After 1 day of coculture, there was no significant difference in levels of TM mRNA between cocultures (144±112 pg/mL) and monocultures (171±100 pg/mL) (Fig 7
). However, after 7 days of coculture, TM mRNA levels were 9±2 pg/mL; monocultures grown in parallel had TM mRNA levels of 189±62 pg/mL. There was no significant association between TM mRNA concentration and CS length for 7-day monoculture or coculture preparations (P>.4 and P>.6, respectively). There were no significant differences in ß-actin mRNA between monocultures and cocultures after 1 and 7 days (Fig 7
). To determine the specificity of the astrocyte findings, we established liver-endothelial coculture preparations under the same conditions used for astrocyte-endothelial cocultures. After 7 days, liver-endothelial cocultures versus endothelial monocultures showed no significant differences in relative abundance of TM mRNA levels: TM mRNA levels for cocultures were 93.4±19.0% of monocultures (P>.6), whereas ß-actin mRNA levels for monocultures were 94.4±9.2% of cocultures (P>.5).
|
| Discussion |
|---|
|
|
|---|
The reduction in TM mRNA in our BBB coculture model is consistent with prior reports. The initial study of TM in the human brain reported an absence of TM protein in brain capillaries; TM was demonstrable in all other organs investigated.24 Later studies reported TM protein present in human brain microvessels25 26 ; however, human brain TM expression was found to be substantially reduced in several subcortical regions where infarction is common.25 Further investigations reported very limited expression of TM protein in capillaries of normal human brain.27 28 Our study examined only expression of TM mRNA in vitro, which limits the implications of our findings. Moreover, TM expression by arterioles and venules was not directly addressed by our study. Nevertheless, the results of the present study are consistent with the contention that expression of TM in brain capillaries is restricted. These data also suggest that astrocytes contribute to this restricted expression.
We have used an in vitro BBB model, comprised of bovine brain microvascular endothelial cells and murine astrocytes, to examine TM mRNA expression by endothelial cells. We deliberately used later-passage endothelial cells, dedifferentiated from a BBB perspective, to examine the effects of inducing elements of the BBB. However, not all features of the BBB have been demonstrated in this model. For example, electrical resistance has not been studied in our coculture system.
Our use of endothelial cells and astrocytes from different species allowed us to selectively examine mRNA from either cell type by taking advantage of differences in genetic composition between species. Nevertheless, our finding of TM mRNA regulation by astrocytes needs to be interpreted with some caution. Our in vitro system contains only astrocytes and endothelial cells; the effects of pericytes, another component of the BBB,11 on brain endothelial hemostasis factors remain undefined. Moreover, despite our astrocyte cultures having virtually complete immunoreactivity for the astrocyte marker GFAP, we cannot entirely rule out the potential contribution of nonastrocytic cells in these coculture preparations. Similarly, despite the presence of the requisite morphological, immunocytochemical, and functional features of our endothelial cell preparations, a potential contribution of nonendothelial cells in our monocultures and cocultures cannot be completed excluded.
Astrocyte effects of TM may be mediated by direct contact between astrocytes and endothelial cells, by the production of a diffusible factor(s) by astrocytes, or both. Our findings cannot distinguish between these potential mechanisms. Prior work has also demonstrated astrocyte enhancement of angiogenesis in vitro.35 36 37 However, it seems unlikely that astrocyte regulation of TM was mediated by angiogenesis in our model: (1) although there was extensive CS development in both endothelial monocultures and astrocyte-endothelial cocultures, TM mRNA expression declined more than 20-fold in the cocultures; (2) there was no significant association between CS length and TM concentration; and (3) increased TM expression has been found in highly vascular malignant gliomas,27 28 suggesting a potential direct (rather than inverse) relationship between angiogenesis and TM expression. However, this latter in vivo finding is not supported by our in vitro data of astrocyte downregulation of TM mRNA. Nevertheless, we cannot entirely rule out a possible inverse relationship between TM expression and angiogenesis in our model.
Astrocytes have the capacity to secrete the cytokines tumor necrosis factor38 and interleukin-1.39 Cell culture studies using non-CNS endothelium have shown that these same cytokines downregulate TM mRNA.40 41 Therefore, further study is warranted to investigate the role of these and other cytokines and growth factors in astrocyte regulation of TM expression.
In conclusion, we have demonstrated that astrocytes negatively regulate brain capillary endothelial cell expression of TM mRNA in vitro. These results suggest that astrocyteendothelial cell interactions at the BBB play an important role in the expression of TM by the brain. Further delineation of BBB regulation of hemostasis may prove helpful for the prevention of thrombotic disorders of the brain, including ischemic stroke.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received March 18, 1996; revision received August 30, 1996; accepted September 5, 1996.
| References |
|---|
|
|
|---|
2.
Salem H, Maruyama I, Ishii H, Majerus PW. Isolation and characterization of thrombomodulin from human placenta. J Biol Chem. 1984;259:12246-12251.
3. Walker FJ, Sexton PW, Esmon CT. The inhibition of blood coagulation by activated protein C through the selective inactivation of activated factor V. Biochim Biophys Acta. 1979;571:333-342.[Medline] [Order article via Infotrieve]
4.
Fulcher CA, Gardiner JE, Griffin JH, Zimmerman TS. Proteolytic inactivation of human factor VIII procoagulant protein by activated human protein C and its analogy with factor V. Blood. 1984;63:486-489.
5.
Kumada J, Dittman WA, Majerus PW. A role for thrombomodulin in the pathogenesis of thrombin-induced thromboembolism in mice. Blood. 1987;71:728-733.
6.
Gomi K, Zushi M, Honda G, Kawahara S, Matsuzaki O, Kanabayashi T, Yamamato S, Maruyama I, Suzuki K. Antithrombotic effect of recombinant human thrombomodulin on thrombin-induced thromboembolism in mice. Blood. 1990;75:1396-1399.
7. Taylor FB, Chang A, Esmon CT, D'Angelo A, Vigano-D'Angelo S, Blick KE. Protein C prevents coagulopathic and lethal effects of Escherichia coli injection in the baboon. J Clin Invest. 1987;79:918-925.
8.
Svensson PJ, Dahlback B. Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med. 1994;330:517-522.
9. Pardridge WM. Advances in cell biology of blood-brain barrier transport. Semin Cell Biol. 1991;2:419-426.[Medline] [Order article via Infotrieve]
10. Goldstein GW. Endothelial cell-astrocyte interactions. Ann N Y Acad Sci. 1988;529:31-39.[Medline] [Order article via Infotrieve]
11. Risau W, Wolburg H. Differentiation of the blood-brain barrier. Trends Neurosci. 1990;13:174-178.[Medline] [Order article via Infotrieve]
12. Stewart PA, Wiley MJ. Developing nervous tissues induces formation of blood-brain barrier characteristics in invading endothelial cells: a study using quail-chick transplantation chimeras. Dev Biol. 1981;84:183-192.[Medline] [Order article via Infotrieve]
13. Tao-Cheng JH, Nagy Z, Brightman MW. Tight junctions to brain endothelium in vitro are enhanced by astroglia. J Neurosci. 1987;7:3293-3299.[Abstract]
14. Dehouck MP, Meresse S, Delorme P, Fruchart JC, Cecchelli R. An easier, reproducible, and mass-production method to study the blood-brain barrier in vitro. J Neurochem. 1990;54:1798-1801.[Medline] [Order article via Infotrieve]
15. Raub TJ, Kuentzel SL, Sawada GA. Permeability of bovine brain microvessels endothelial cells in vitro: barrier tightening by a factor released from astroglioma cells. Exp Cell Res. 1992;199:330-340.[Medline] [Order article via Infotrieve]
16.
DeBault LE, Cancilla PA. Gamma-glutamyl transpeptidase in isolated brain endothelial cells: induction by glial cells in vitro. Science. 1980;207:653-655.
17.
Dehouck B, Dehouck MP, Fruchart JC, Cecchelli R. Upregulation of the low density lipoprotein at the blood-brain barrier: intercommunications between brain capillary endothelial cells and astrocytes. J Cell Biol. 1994;126:465-473.
18. Fisher M. Immunohematologic mechanisms in stroke. In: Caplan LR, ed. Brain Ischemia: Basic Concepts and Clinical Relevance. New York, NY: Springer-Verlag; 1995:7-103.
19. Zlokovic BV, Wang L, Sun N, Haffke S, Verrall S, Seeds NW, Fisher MJ, Schreiber SS. Expression of tissue plasminogen activator in the cerebral capillaries: possible fibrinolytic function of the blood-brain barrier. Neurosurgery. 1995;37:955-961.[Medline] [Order article via Infotrieve]
20.
Kittaka M, Wang L, Sun N, Schreiber SS, Seeds NW, Fisher M, Zlokovic BV. Brain capillary tissue plasminogen activator in a diabetes stroke model. Stroke. 1996;27:712-719.
21. Wang L, Kittaka M, Sun N, Schreiber SS, Zlokovic BV. Chronic nicotine treatment enhances focal ischemic brain injury and depletes free pool of brain microvascular tissue plasminogen activator in rats. J Cereb Blood Flow Metab. In press.
22. Okada Y, Copeland BR, Fitridge R, Koziol JA, del Zoppo GJ. Fibrin contributes to microvascular obstructions and parenchymal changes during early focal cerebral ischemia and reperfusion. Stroke. 1994;25:1847-1854.[Abstract]
23.
Snow TR, Deal MT, Dickey DT, Esmon CT. Protein C activation following coronary artery occlusion in the in situ porcine heart. Circulation. 1991;84:293-299.
24.
Ishii H, Salem HH, Bell CE, Laporata EA, Majerus PW. Thrombomodulin, an anticoagulant protein, is absent in the human brain. Blood. 1986;67:362-365.
25. Wong VLY, Hofman FM, Ishii H, Fisher M. Regional distribution of thrombomodulin in the human brain. Brain Res. 1991;556:1-5.[Medline] [Order article via Infotrieve]
26. Boffa MC, Jackman RW, Peyri N, Boffa JF, George B. Thrombomodulin in the central nervous system. Nouv Rev Fr Hematol. 1991;33:423-429.
27. Isaka T, Yoshimine T, Motokiko M, Kurode R, Ishii H, Hayakawa T. Altered expression of antithrombotic molecules in human glioma vessels. Acta Neuropathol (Berl). 1994;87:81-85.[Medline] [Order article via Infotrieve]
28. Maruno M, Yoshimine T, Isaka T, Kurode R, Ishii H, Mayakawa T. Expression of thrombomodulin in astrocytomas of various malignancy and in gliotic and normal brain. J Neurooncol. 1994;19:155-160.[Medline] [Order article via Infotrieve]
29. Minakawa T, Bready J, Berliner J, Fisher M, Cancilla PA. In vitro interactions of astrocytes and pericytes with capillary-like structures of brain microvessel endothelium. Lab Invest. 1991;65:32-40.[Medline] [Order article via Infotrieve]
30. Carson MP, Haudenschild CC. Microvascular endothelium and pericytes: high yield, low passage cultures. In Vitro Cell Dev Biol. 1986;22:344-354.[Medline] [Order article via Infotrieve]
31.
McCarthy KD, DeVellis J. Preparation of separate astroglial and oligodendroglial cell cultures from rat cerebral tissue. J Cell Biol. 1980;85:890-902.
32. Rutenburg AM, Kim H, Fischbein JW, Hanker JS, Wasserkrug HL, Seligman AM. Histochemical and ultrastructural demonstration of gamma-glutamyl transpeptidase activity. J Histochem Cytochem. 1969;17:517-526.[Abstract]
33.
Jackman RW, Beeler DL, DeWaters L, Rosenberg RD. Characterization of a thrombomodulin cDNA reveals structural similarity to the low density lipoprotein receptor. Proc Natl Acad Sci U S A. 1986;83:8834-8838.
34.
Higuchi R, Krummel B, Saiki K. A general method of in vitro preparation and mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 1988;16:7351-7367.
35. Laterra J, Guerin C, Goldstein GW. Astrocytes induce neural microvascular endothelial cells to form capillary-like structures in vitro. J Cell Physiol. 1990;144:204-215.[Medline] [Order article via Infotrieve]
36. Laterra J, Indurti RR, Goldstein GW. Regulation of in vitro glia-induced microvessel morphogenesis by urokinase. J Cell Physiol. 1994;158:317-324.[Medline] [Order article via Infotrieve]
37. Laterra J, Goldstein GW. Astroglial induced in vitro angiogenesis: requirements for RNA and protein synthesis. J Neurochem. 1991;57:1231-1239.[Medline] [Order article via Infotrieve]
38. Chung I, Norris G, Benveniste E. Tumor necrosis factor alpha production by astrocytes: induction by lipopolysaccharide, IFN-gamma, and IL-1 beta. J Immunol. 1990;144:2999-3007.[Abstract]
39. Fontana A, Kristensen F, Dubs R, Gemsa D, Weber E. Production of prostaglandin E and an interleukin-1 like factor by cultured astrocytes and C6 glioma cells. J Immunol. 1982;129:2413-2419.[Abstract]
40.
Conway EM, Rosenberg RD. Tumor necrosis factor suppresses transcription of the thrombomodulin gene in endothelial cells. Mol Cell Biol. 1988;8:5588-5592.
41. Hirokawa K, Aoki N. Regulatory mechanisms for thrombomodulin expression in human umbilical vein endothelial cells in vitro. J Cell Physiol. 1991;147:157-165.[Medline] [Order article via Infotrieve]
Department of CardiologyDuke University Medical CenterDurham, NC
| Introduction |
|---|
|
|
|---|
Another potentially important adaptation of the CNS vasculature is the relatively limited expression of TM, a thrombin-binding protein on the endothelial cell surface that functions in an anticoagulant pathway that results in the inactivation of factor VIIIa and Va.4R 5R 6R 7R 8R Although the functional significance of decreased TM expression by CNS endothelium is unclear, teleologically it makes sense, since a bleed into the brain may be more catastrophic than a small clot. Thus, the evolutionary pressure may be toward a decreased anticoagulant surface for brain endothelium versus other endothelium where a bleed may be somewhat less disabling than a clot. While this adaptation may yield a reproductive and therefore evolutionary advantage, it may be a detriment in older individuals or in individuals with genetic or acquired hypercoagulability. For example, the decreased anticoagulant capacity of the CNS endothelium could contribute to vascular dementia due to multiple lacunar infarctions. Consistent with a role for decreased TM expression in the propensity for lacunar infarction is the prevalence of these lesions in the basal ganglia and deep white matter of the brain, regions thought to have particularly limited expression of TM.9R
In this issue of Stroke, Tran and coworkers have examined the mechanism of TM downregulation in endothelium of the BBB using an in vitro coculture assay. In this study, multipassage cultures of brain capillary endothelial cells were found to have lost their BBB characteristics by virtue of decreased expression of GGTP and upregulation of TM. When these endothelial cells were cocultured with astrocytes, they reacquired their microvascular and BBB phenotype by forming capillary structures that, over time, upregulated GGTP and downregulated TM. Although these endothelial cells formed capillary structures when cocultured with hepatocytes, no change in TM expression could be measured, suggesting that downregulation of TM by brain endothelium may be induced by a specific interaction with astrocytes. The questions remaining to be answered include whether regulation of TM expression by astrocytes is due to a secreted factor or whether cell-cell contact is required. Another intriguing question is whether microvascular endothelial cells not originating in the CNS respond to astrocyte coculture by downregulating TM in response to specific interactions with astrocytes, or whether brain microvascular endothelial cells are specifically preprogrammed to respond in this manner. It is likely that insights into these questions could be obtained using coculture systems such as the one used by Tran and coworkers. As is true regarding modulation of the barrier functions of the CNS vasculature, insights into the molecular mechanisms controlling the procoagulant and anticoagulant properties of CNS vasculature could lead to a better understanding of thrombotic disorders in the CNS and perhaps provide the basis for innovative therapeutic approaches.
| Selected Abbreviations and Acronyms |
|---|
|
After 1 and 7 days, astrocyte-endothelial coculture and endothelial monoculture preparations were examined by (1) immunohistochemistry for von Willebrand factor and GFAP and (2) histochemical staining for GGTP. Data indicate percentage of von Willebrand factor and GFAP-immunoreactive cells, percentage of astrocytes associated with CS, and presence of GGTP staining.
| References |
|---|
|
|
|---|
2R.
Wang B-L, Grammas P, de Bault I. Characterization of a
-glutamyl transpeptidase positive subpopulation of endothelial cells in a spontaneous tube-forming clone of rat cerebral resistance-vessel endothelium. J Cell Physiol.. 1993;156:531-540.[Medline]
[Order article via Infotrieve]
3R.
Rubin LL, Hall DE, Porter S, Barbu K, Cannon C, Horner HC, Janatpour M, Liaw CW, Manning K, Morales J, Tanner LI, Tomaselli KJ, Bard F. A cell culture model of the blood-brain barrier. J Cell Biol.. 1991;115:1725-1735.
4R. Ishii H, Salem HH, Bell CE, Laposata EA, Majerus PW. Thrombomodulin, an endothelial anticoagulant protein, is absent from the human brain. Blood.. 1986;67:362-365.
5R. Isaka T, Yoshimine T, Maruno M, Kuroda R, Ishii H, Hayakawa T. Altered expression of antithrombotic molecules in human glioma vessels. Acta Neuropathol (Berl).. 1994;87:81-85.
6R. Maruno M, Yoshimine T, Isaka T, Kuroda R, Ishii H, Hayakawa T. Expression of thrombomodulin in astrocytomas of various malignancies and in gliotic and normal brains. J Neurooncol.. 1994;19:155-160.
7R. Wong VLY, Hofman FM, Ishii H, Fisher M. Regional distribution of thrombomodulin in human brain. Brain Res.. 1991;556:1-5.
8R. Esmon CT. Thrombomodulin as a model of molecular mechanisms that modulate protease specificity and function at the vessel surface. FASEB J.. 1995;9:946-955.[Abstract]
9R.
Kario K, Matsuo T, Kobayashi H, Asada R, Matsuo M. `Silent' cerebral infarction is associated with hypercoagulability, endothelial cell damage, and high Lp(a) levels in elderly Japanese. Arterioscler Thromb Vasc Biol.. 1996;16:734-741.
This article has been cited by other articles:
![]() |
J. Ai Kim, C. C. Hedrick, Dangci Xie, and M. J. Fisher Adenoviral-Mediated Transfer of Tissue Plasminogen Activator Gene into Brain Capillary Endothelial Cells In Vitro Angiology, September 1, 2001; 52(9): 627 - 634. [Abstract] [PDF] |
||||
![]() |
M. Shibata, S. R. Kumar, A. Amar, J. A. Fernandez, F. Hofman, J. H. Griffin, and B. V. Zlokovic Anti-Inflammatory, Antithrombotic, and Neuroprotective Effects of Activated Protein C in a Murine Model of Focal Ischemic Stroke Circulation, April 3, 2001; 103(13): 1799 - 1805. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. D. Tran, J. Correale, S. S. Schreiber, M. Fisher, and P. H. Chan Transforming Growth Factor-{beta} Mediates Astrocyte-Specific Regulation of Brain Endothelial Anticoagulant Factors • Editorial Comment Stroke, August 1, 1999; 30(8): 1671 - 1678. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Macko, L. A. Killewich, J. A. Fernandez, D. K. Cox, A. Gruber, and J. H. Griffin Brain-Specific Protein C Activation During Carotid Artery Occlusion in Humans Stroke, March 1, 1999; 30(3): 542 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, N. D. Tran, M. Kittaka, M. J. Fisher, S. S. Schreiber, and B. V. Zlokovic Thrombomodulin Expression in Bovine Brain Capillaries : Anticoagulant Function of the Blood-Brain Barrier, Regional Differences, and Regulatory Mechanisms Arterioscler Thromb Vasc Biol, November 1, 1997; 17(11): 3139 - 3146. [Abstract] [Full Text] |
||||
![]() |
J.-M. Olivot, E. Estebanell, M. Lafay, B. Brohard, M. Aiach, and F. Rendu Thrombomodulin Prolongs Thrombin-Induced Extracellular Signal-Regulated Kinase Phosphorylation and Nuclear Retention in Endothelial Cells Circ. Res., April 13, 2001; 88(7): 681 - 687. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Stroke Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1996 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |