(Stroke. 1996;27:1373-1380.)
© 1996 American Heart Association, Inc.
Articles |
the Laboratory of Cerebrovascular Biology and Stroke, Department of Neurology, and the Division of Neuropathology, Departments of Neurology and Laboratory Medicine and Pathology (H.B.C.), University of Minnesota Medical School (Minneapolis).
Correspondence to C. Iadecola, MD, Department of Neurology, University of Minnesota Medical School, Box 295 UMHC, 420 Delaware St SE, Minneapolis, MN 55455. E-mail iadec001@maroon.tc.umn.edu.
| Abstract |
|---|
|
|
|---|
Methods The middle cerebral artery in rats was occluded for 2 hours by an intraluminal filament. The occurrence of transient ischemia and reperfusion was confirmed by laser-Doppler flowmetry (n=5). iNOS message in the ischemic neocortex was determined by reverse-transcription polymerase chain reaction. iNOS enzymatic activity was assessed by citrulline assay. The cellular localization of iNOS expression was determined by immunohistochemistry.
Results iNOS mRNA was maximally expressed in postischemic brain at 12 hours and was not present at 4 days (n=3 per time point). iNOS mRNA was not observed in the contralateral cerebral cortex. iNOS enzymatic activity developed in the postischemic brain between 12 and 24 hours (P<.05) and subsided at 4 days (n=4 to 8 per time point). iNOS immunoreactivity in the ischemic region was restricted to the wall of capillaries and of larger blood vessels at 12 to 24 hours. In regions of early necrosis, inflammatory cells were iNOS positive. Treatment with the iNOS inhibitor aminoguanidine (n=5; 100 mg/kg IP, BID for 4 days), starting 6 hours after ischemia, reduced infarct size in neocortex by 36±7% in comparison with vehicle-treated controls (n=5) (P<.05).
Conclusions Transient focal ischemia leads to iNOS expression in postischemic brain. However, the spatial and temporal patterns of expression differ from those occurring in permanent ischemia: iNOS is induced earlier and predominantly in vascular cells rather than in neutrophils. Thus, the temporal profile and localization of postischemic iNOS expression depend on the nature of the ischemic insult. The finding that aminoguanidine reduces infarct size adds further support to the hypothesis that postischemic iNOS expression contributes to ischemic brain damage.
Key Words: cerebral ischemia gene expression immunohistochemistry nitric oxide synthase rats
| Introduction |
|---|
|
|
|---|
There is evidence that the acute inflammatory reaction associated with cerebral ischemia contributes to the development of the brain damage. First, the infarct produced by MCA occlusion is smaller in rats depleted of circulating leukocytes.9 5 Second, if the accumulation of leukocytes in the ischemic brain is prevented by antibody directed against adhesion molecules, the volume of the infarct is also reduced.10 11 12 13 Third, intracerebroventricular injection of blocking antibodies directed against the cytokine IL-1
receptor reduces the infarct resulting from MCA occlusion, whereas injection of IL-1
exacerbates the damage.14
However, the mechanisms by which postischemic inflammation exerts its deleterious effects on the brain have not been elucidated (see References 15 and 16 for a review). In models of inflammation in other systems, expression of iNOS has been shown to mediate cellular damage (see Reference 17). iNOS produces NO continuously and in large, potentially cytotoxic, amounts.18 Recent data from this laboratory suggest that iNOS may be involved also in the inflammatory reaction that follows cerebral ischemia. iNOS mRNA and enzymatic activity are expressed in brain after permanent MCA occlusion, whereas iNOS immunoreactivity is present in infiltrating neutrophils.19 20 Treatment with the relatively selective iNOS inhibitor AG reduces infarct volume, suggesting that iNOS activity contributes to ischemic brain damage.21 These data indicate that NO production by iNOS in neutrophils is one of the mechanisms by which postischemic inflammation causes brain damage.
Little is known, however, about iNOS expression after transient MCA occlusion, a model that reproduces more closely the transient ischemic insult that frequently occurs in human stroke.22 Although initial data suggest that iNOS message is induced also after transient MCA occlusion,23 it remains to be established (1) whether the temporal pattern of iNOS expression and the cell type in which iNOS is expressed are similar to those observed in permanent ischemia and (2) whether iNOS message induction is associated with development of iNOS enzymatic activity in the postischemic brain.
Therefore, in this study we investigated the pattern of expression of iNOS mRNA and enzymatic activity after transient occlusion of the rat MCA. Interestingly, we found that the temporal profile and cellular localization of iNOS expression differ from those observed in permanent ischemia. It was also found that treatment with the iNOS inhibitor AG reduces focal cerebral ischemic damage. While the results strengthen the evidence for a pathogenic role of iNOS induction in cerebral ischemia, they suggest that the time course and cellular localization of the iNOS expression are not stereotyped but depend on the characteristics of the ischemic insult.
| Materials and Methods |
|---|
|
|
|---|
Procedures for Transient MCA Occlusion
Studies were approved by the animal care committee of the University of Minnesota. Experiments were conducted in 79 male Sprague-Dawley rats (Harlan) weighing 300 to 400 g. Transient MCA occlusion was produced using an intravascular occlusion model26 that has been described in detail previously.23 With rats under halothane anesthesia (induction, 5%; maintenance, 1% in an oxygen-nitrogen mixture), a 4-0 nylon monofilament with a rounded tip was inserted centripetally into the external carotid artery and advanced into the internal carotid until a slight resistance was felt. Such resistance indicated that the filament had reached the circle of Willis. Throughout the procedure, body temperature was maintained at 37±0.5°C with a thermostatically controlled infrared lamp. Two hours after induction of ischemia, rats were reanesthetized and the filament was withdrawn. Animals were then returned to their cages and closely monitored until they recovered from anesthesia. In sham-operated rats, the external carotid artery was surgically prepared for insertion of the filament, but the filament was not inserted. Rats were killed at different time points after transient ischemia for iNOS mRNA determination, for measurement of iNOS enzymatic activity, or for immunocytochemistry (see below).
Monitoring of CBF With Laser-Doppler Flowmetry
In five rats, CBF was monitored in the cerebral cortex ipsilateral to the occluded MCA with a laser-Doppler flowmeter (BPM, Vasamedic 403A).25 Rats were anesthetized with halothane and prepared for MCA occlusion as described above. Body temperature was monitored and controlled. A catheter was inserted into the femoral artery for continuous monitoring of arterial pressure and for measuring arterial blood gases with a blood gas analyzer (model 178, CIBA-Corning). Rats were then intubated, placed on a stereotaxic frame (Kopf), and artificially ventilated with an oxygen-nitrogen mixture. The skull was exposed, and a hole 1 to 2 mm in diameter was drilled with the assistance of a dissecting scope at a site 2.5 to 3 mm lateral to the midline and 4.2 to 4.5 mm rostral to the interaural line.25 The dura was left intact, and the laser-Doppler flowmeter probe (tip diameter, 0.8 mm) was positioned 0.5 mm above the dural surface. The analogue output of the flowmeter was fed into a DC amplifier (Grass) and displayed on the polygraph. Once a stable CBF signal was obtained, the filament was advanced into the external carotid artery until the MCA was occluded. Two hours later, the filament was withdrawn. CBF monitoring was continued up to 1 hour after reperfusion. At the end of the experiments, rats were killed with an intravenous bolus of saturated KCl while still anesthetized.
RT-PCR
iNOS mRNA was detected in the ischemic brain using RT-PCR as previously described.20 24 A 4-mm-thick coronal brain slice was cut at the level of the optic chiasm, and the infarcted cortex was dissected using the corpus callosum as a ventral landmark. The corresponding region of the contralateral cortex was also sampled. Total RNA was extracted from the tissue using the method of Chomczynski and Sacchi.27 The integrity of the RNA was determined on denaturing formaldehyde gels. First-strand cDNA synthesis was then carried out using 0.25, 0.5, and 1.0 µg of total RNA, oligo(dT) primer (New England BioLabs), and superscript II (BRL) reverse transcriptase according to manufacturer's instructions. Aliquots (5 µL each) from the RT reaction were then used for PCR amplification with primer pairs for both iNOS and a ubiquitously expressed control sequence PBD. NOS primer sequences were chosen for their ability to distinguish iNOS from the other NOS isoforms and were designed to flank a known intron-exon boundary of the genomic iNOS sequence.24 Therefore, only products corresponding to the iNOS mRNA were amplified in the RT-PCR reactions. This eliminates the concern that products might be generated from genomic DNA contaminants in the RNA samples. The iNOS primer pair used was as follows: forward: 5' ACAACGTGGAGAAAACCCCAGGTG 3'; reverse: 5' ACAGCTCCGGGCATCGAAGACC 3'. The PBD primer pair used was forward: 5' GCCACCACAGTCTCGGTCTGTATGCGACG 3' and reverse: 5' TGTCCCGGTAACGGCGGCGCGGCCACAAC3'. iNOS and PBD were amplified in the same reaction. The "hot start" method was used (Stratagene) with the following cycle parameters: 94°C, 15 seconds; 68°C, 30 seconds; 73°C, 20 seconds for five cycles, then 94°C, 15 seconds, 62°C, 30 seconds; 73°C, 20 seconds for 35 cycles. Reaction products were then separated on an 8% polyacrylamide gel, ethidium stained, and photographed before resolved bands were transferred to nylon filters. The size of the PCR fragments representing iNOS and PBD were 557 and 120 bp, respectively. Southern blot analysis of filters with the use of an internal iNOS and PBD cDNA was then performed to confirm the identity of RT-PCR products.20 24 Each set of PCR reactions included control samples run without RNA or in which the RT step was omitted. The RT-PCR procedure was highly reproducible under the present experimental conditions.20 23 24
Measurement of Brain iNOS Activity After Transient Cerebral Ischemia
Samples from the ischemic cortex and the contralateral intact cortex were collected as described in the previous section, frozen in liquid nitrogen within 1 minute, stored at -80°C, and assayed 1 to 3 days after collection. iNOS catalytic activity of the postischemic cortex was determined by the citrulline assay of Bredt and Snyder, modified for detection of calcium-independent activity.19 Brain samples were homogenized in 20 mmol/L HEPES containing 0.5 mmol/L EGTA, 1 mmol/L dithiothreitol, and 0.32 mol/L glucose at 23 000 rpm for 30 seconds (Polytron/PT3000, Brinkmann). The homogenate was centrifuged at 20 000g for 15 minutes. Triplicate aliquots of cytosol (150 µg protein) were incubated for 45 minutes (37°C) with a buffer (pH 7.4) containing 20 mmol/L HEPES, 0.5 mmol/L EGTA, 1 mmol/L dithiothreitol, 0.32 mol/L sucrose, 200 µmol/L NADPH, tetrahydrobiopterin (50 µmol/L), FMN (1 µmol/L), FAD (1 µmol/L), 1 µmol/L L-arginine, and 1 µCi/mL [3H]L-arginine. The reaction buffer was devoid of calcium. The reaction was stopped by adding 2 mL of ice-cold 20 mmol/L HEPES (pH 5.5). Samples were applied to Dowex AG50W-X8 (Na+ form) columns to remove [3H]L-arginine. Columns were then washed with 2 mL of water, and [3H]L-citrulline was quantified in the flow-through fraction with a liquid scintillation spectrophotometer (LS 6000, Beckman). The level of [3H]L-citrulline was computed after subtraction of the blank value that represents nonspecific radioactivity in the absence of enzyme. The protein concentration of the brain samples was determined with Lowry's method using albumin as standard. Procedures for validation of the iNOS assay have been described in full previously.19
Immunocytochemistry
Immunocytochemical procedures were identical to those described in previous publications from this laboratory.20 19 Briefly, rats (n=3 per time point) were anesthetized (pentobarbital, 100 mg/kg IP) and perfused through the heart with 4% paraformaldehyde. Brains were removed, post-fixed, and embedded in paraffin. Coronal sections (7 µm) through the infarct were cut with a microtome and mounted on microscope slides. Sections were deparaffinized, rehydrated, quenched with hydrogen peroxide, washed, and incubated with horse serum (Vector) for 3 hours. Sections were then incubated overnight (4°C) with a polyclonal iNOS antibody (Upstate Biotechnology Incorporated; dilution, 1:200), washed, and incubated with the secondary antibody (Vector) for 30 minutes. The immunocomplex was visualized using the diaminobenzidine chromogen in a peroxidase reaction (ABC complex; Vectastain Elite Kit, Vector). Alternate sections were processed for glial fibrillary acidic protein immunocytochemistry. To assist in the determination of the cellular localization of the label, some sections were counterstained with hematoxylin and eosin. Slides were viewed and photographed by use of a microscope (Optiphot, Nikon).
Effect of AG on Infarct Volume
With animals under halothane anesthesia, the left femoral artery was cannulated and rats were placed on a stereotaxic frame. The arterial catheter was connected to a pressure transducer for recording of mean arterial pressure and heart rate. Plasma glucose was measured with a glucose analyzer (Beckman). The MCA was occluded for 2 hours using the string method as described above. After completion of the surgical procedures, the arterial catheter was tunneled under the skin and exteriorized at the level of the tail. The catheter was used for recording of arterial pressure and for measurement of plasma glucose and hematocrit at different times after MCA occlusion.
Treatments were begun 6 hours after induction of ischemia. In one group of rats (n=5), AG (Sigma; 100 mg/kg in 1 mL saline) was administered intraperitoneally at 10 AM and 6 PM for 4 consecutive days. A second group of rats (n=5) was treated with vehicle (saline; 1 mL at 10 AM and 6 PM) for 4 days. The pH of the solutions injected was adjusted to 7.0. We have previously demonstrated that treatment with AG according to this protocol inhibits postischemic brain iNOS activity without affecting brain cNOS activity, CBF, cerebrovascular reactivity to hypercapnia, or arterial pressure.21 Arterial pressure, rectal temperature, and plasma glucose were measured daily at 9 AM, 1 PM, 5 PM, and 9 PM. Arterial hematocrit was measured before injection and 24, 48, 72, and 96 hours after ischemia.
Four days after induction of ischemia, rats were killed for determination of infarct size. Brains were removed and frozen in cooled isopentane (-30°C). Coronal forebrain sections (thickness, 30 µm) were serially cut in a cryostat, collected at 300-µm intervals, and stained with thionin. As described in detail elsewhere,25 infarct volume was determined using an image analyzer (MCID, Imaging Research Inc). Infarct volume in cerebral cortex was corrected for swelling according to the method of Lin et al28 as previously described.21
Data Analysis
Data presented in the text, Table, and Figures are expressed as mean±SE. Comparisons among multiple groups were statistically evaluated by ANOVA and the Tukey-Kramer modification of Tukey's test (Systat Inc). Comparisons between two groups were evaluated by the Student's t test. Differences were considered significant at a value of P<.05.
| Results |
|---|
|
|
|---|
|
iNOS mRNA Expression After Transient Ischemia
In these studies, we used RT-PCR to define the time course of iNOS mRNA after transient ischemia. In sham-operated rats (data not shown) or in rats 6 hours after transient MCA occlusion, iNOS mRNA was not observed in either side of the brain (Fig 2
). However, 12 hours after ischemia, a robust iNOS signal was detected in the ischemic cortex but not contralaterally. iNOS mRNA was still present at 1 and 2 days after ischemia but was not observed at 4 and 7 days. No signals were obtained if the reverse transcriptase step of the reaction was omitted or if no RNA was added (Fig 2
). These data demonstrate that iNOS mRNA is expressed after transient ischemia.
|
iNOS Enzymatic Activity in the Postischemic Brain
We then sought to determine whether iNOS enzymatic activity is increased after transient ischemia. Neocortical iNOS enzymatic activity was negligible in sham-operated rats. After transient ischemia, iNOS activity developed in the postischemic brain but not contralaterally (Fig 3
). The enzymatic activity was present at 12 hours (P<.05 from the contralateral side), was maximal at 1 day (P<.05), and subsided at 4 days (P>.05). These data demonstrate that, in addition to iNOS mRNA, iNOS enzymatic activity is also expressed in the postischemic brain.
|
Cellular Localization of iNOS Expression After Transient Cerebral Ischemia
The results of the studies described above suggest that transient cerebral ischemia is associated with expression of iNOS mRNA and enzymatic activity. In these experiments, we used immunocytochemistry to identify the cell type(s) in which iNOS is expressed. iNOS immunoreactivity was observed in vessels throughout the ischemic region. Vessels 8 to 15 µm in diameter (Fig 4D
) were stained homogeneously, suggesting localization of the reaction product to all cells within the vascular wall. In vessels 30 to 100 µm in diameter, the label was distributed less homogeneously (Fig 4A and 4B![]()
). iNOS immunoreactivity was sometimes observed in large extraparenchymal arteries supplying the ischemic hemisphere, wherein the label was seen in patches within the smooth muscle layer and in endothelial cells (Fig 4C
). iNOS immunoreactivity was also seen in thin-walled vessels, presumably venules (Fig 4E
). The immunostain was observed at 12 hours and 1 day after ischemia. Two days after ischemia, iNOS immunoreactivity was present but diminished, and at 4 days no label was observed. In areas of early necrosis, involving mainly the medial portion of the striatum, immunoreactivity was also observed in mononuclear and polymorphonuclear cells invading the infarcted tissue (Fig 4F
). The iNOS immunoreactivity in these cells also disappeared by 2 days after ischemia.
|
Effect of AG on Infarct Volume After Transient Cerebral Ischemia
To study whether iNOS expression contributes to ischemic brain damage, rats were subjected to transient MCA occlusion and then treated with the relatively selective iNOS inhibitor AG. AG was administered according to a protocol that was previously demonstrated to inhibit iNOS, but not cNOS, in ischemic brain.21 The time course of the changes in arterial pressure, plasma glucose level, and rectal temperature in rats after transient ischemia with or without AG treatment is illustrated in Fig 5
. Transient ischemia did not affect arterial blood pressure, blood glucose, or hematocrit (P>.05) but produced a sustained elevation in rectal temperature (P<.05). Hyperthermia has been previously observed in this model and has been attributed to ischemia/infarction in hypothalamic regions involved in temperature regulation.30 23 Treatment with AG did not affect arterial pressure, plasma glucose, or the elevation in temperature associated with transient ischemia (Fig 5
). However, this inhibitor decreased the size of the neocortical infarct by 32% (P<.05), a reduction that reached 36% after correction for postischemic swelling (Table
, Fig 6
). AG also reduced infarct volume in the striatum, but the effect did not reach statistical significance (P>.05) (Table
, Fig 6
).
|
|
|
| Discussion |
|---|
|
|
|---|
Exclusion of Potential Sources of Artifact
The expression of iNOS in this model cannot be attributed to experimental manipulations or to causes other than cerebral ischemia. The model for MCA occlusion using the intraluminal filament does not require a craniotomy, a procedure that interferes with cerebrospinal fluid dynamics and induces an inflammatory reaction related to the trauma of the surgery. Indeed, in our previous study in which the MCA was permanently occluded intracranially, iNOS expression was noticed also in sham-operated rats,20 suggesting that the trauma of the surgical procedure was sufficient to induce iNOS. In contrast, in the string model, no iNOS mRNA induction was observed in sham-operated rats or contralateral to the occluded MCA. Therefore, it is unlikely that the iNOS expression was secondary to the trauma of the procedure used to occlude the MCA rather than to cerebral ischemia. It also is unlikely that iNOS mRNA expression was due to artifacts deriving from the RT-PCR technique used in our experiments. First, the RT-PCR technique for detection of iNOS mRNA has been extensively tested in our laboratory and found to be reliable and specific.20 23 24 Second, the RT-PCR data indicating iNOS expression were corroborated by immunocytochemical evidence of iNOS protein expression and biochemical evidence of iNOS catalytic activity. Therefore, multiple independent observations support the occurrence of iNOS expression. Finally, the protective effect of AG cannot be attributed to changes in arterial pressure, plasma glucose, or body temperature because these parameters were monitored and did not differ between treated and untreated groups. Although MCA occlusion produced hyperthermia, the degree of temperature elevation did not differ between treated and untreated rats. Therefore, the findings of the present study cannot result from artifacts related to surgical procedures, techniques for mRNA detection, or differences in the physiological state of the rats.
Mechanisms of iNOS Induction After Transient Cerebral Ischemia
The mechanisms by which iNOS is expressed after cerebral ischemia have not been elucidated. Studies of iNOS induction in macrophages suggest that iNOS transcription is activated by endotoxin and cytokines, mainly bacterial lipopolysaccharide and interferon-
31 (see Reference 32 for a review). Inducibility by interferon-
and lipopolysaccharide requires iNOS promoter consensus sequences for binding of the transcription factors interferon regulatory factor-1 and nuclear factor-
B, respectively.33 34 35 Several cytokines are expressed in the ischemic brain, including tumor necrosis factor-
, IL-1ß, and IL-6.36 37 38 One possibility, therefore, is that brain-derived cytokines induce iNOS expression in susceptible cells. Cytokines may diffuse extracellularly and activate iNOS expression in inflammatory cells and in local microvessels. It seems unlikely, however, that this mechanism would explain the induction observed in large vessels located outside the brain parenchyma because these vessels are beyond the reach of tissue-derived cytokines. Perhaps, reperfusion could activate iNOS transcription via the shear-stress responsive element reported in the iNOS promoter of human vascular smooth muscle cells39 (see below also).
Time Course and Cellular Localization of Postischemic iNOS Expression
The results of the present study indicate that the pattern of iNOS expression after cerebral ischemia differs depending on whether the ischemic insult is transient or permanent. In permanent ischemia, the reduction in blood flow is stable, leading to severe irreversible ischemia.25 In transient ischemia, a period of intense flow reduction is followed by reperfusion of previously ischemic territory. Therefore, the differences in the timing of iNOS expression in transient and permanent ischemic could very well reflect differences in the pathogenic mechanisms of the brain damage in transient versus permanent ischemia. For example, in transient ischemia, the inflammatory response is more pronounced and occurs earlier than in permanent ischemia.40 Conceivably, the earlier release of the factors responsible for iNOS induction could account for the earlier iNOS expression observed in transient ischemia. The difference in the cellular localization of the expression between transient and permanent ischemia is unexpected and more difficult to explain. Vascular iNOS expression in transient ischemia may be related to the occurrence of reperfusion of previously ischemic vessels. However, the mechanisms of the effect cannot be determined on the basis of the present study. One possibility is that changes in the vascular redox state after reperfusion activate transcription factors in vascular cells that, either directly or via their induced gene products, turn on iNOS expression.41 Another possibility is that reestablishment of flow leads to activation of a shear-stress response element, the consensus sequence of which has been reported in the iNOS promoter of human vascular smooth muscle cells.39 Although the lack of postischemic hyperemia in this model argues against a global increase in shear stress during reperfusion, it is possible that an increase in shear stress occurred in selected hyperperfused vessels.
Pathogenic Role of iNOS Induction in Transient Cerebral Ischemia
Another finding of the study was that the iNOS inhibitor AG reduces cerebral ischemic damage also in transient cerebral ischemia. In a previous study, we found that administration of AG starting 24 hours after a 2-hour MCA occlusion reduced infarct size by 26%.23 In the present study, AG administration starting 6 hours after induction of ischemia reduced infarct size by 36%. The difference in the magnitude of the protection is probably due to the fact that in the present study AG administration was targeted to the period during which iNOS is expressed. Therefore, the brain tissue was better protected from the consequences of NO production by iNOS. Irrespective of the magnitude of the protection, the observation that AG reduces infarct size adds further support to the hypothesis that NO produced by iNOS is deleterious to the postischemic brain and that inhibition of iNOS synthesis may be of value in the treatment of the late stages of cerebral ischemia. However, the possibility that AG acts via mechanisms independent of iNOS inhibition cannot be entirely ruled out on the basis of the present study. Similarly, the possibility that AG acts by inhibiting iNOS expression rather than iNOS activity cannot be ruled out. Experiments using more specific iNOS inhibitors, structurally unrelated to AG, are needed to address the issues of drug specificity.
The mechanisms by which iNOS expression, hence NO overproduction, contributes to the tissue damage in transient ischemia remain to be defined. Whereas parenchymal NO overproduction by inflammatory cells could produce direct cytotoxic effects in the surrounding brain, the contribution of vascular NO overproduction to the tissue damage is more difficult to assess. On the one hand, vascular NO could alter microvascular permeability and contribute to the cerebrovascular dysregulation that follows cerebral ischemia.42 43 On the other hand, NO may cause damage by reacting with superoxide and producing peroxynitrite. Peroxynitrite, a relatively stable anion, can diffuse away from the vessel and contribute to tissue damage by generating hydroxyl radicals.44 Another possibility is that low levels of iNOS expression in intrinsic brain cells, eg, glia and neurons, were missed by immunocytochemistry. It is, therefore, possible that iNOS expression, hence NO production, is more widespread than suggested by the immunocytochemical data. Further studies will be required to explore these possibilities.
NO and Cerebral Ischemic Damage
The results of the present study and those of previous investigations from this and other laboratories suggest that the role of NO in the mechanisms of cerebral ischemia is multifaceted. In the initial stages (<2 hours) immediately after induction of ischemia, NO is beneficial to the tissue because it promotes vasodilation, inhibits platelet aggregation, and increases flow to penumbral regions at risk for infarction.25 45 The vascular effects of NO, however, are short-lived and are no longer protective 2 hours after induction of ischemia.46 In the intermediate stage (2 to 6 hours) after cerebral ischemia, NO production in the ischemic area, predominantly from neuronal NOS, becomes deleterious to the ischemic tissue and aggravates the damage.47 48 In the late stages after cerebral ischemia (>6 hours), NO produced in large amounts by iNOS induction in the postischemic tissue is also pathogenic to the brain and contributes to the progression of the tissue damage.21 23 Therefore, although NO participates in the mechanisms of cerebral ischemia, its role is either protective or destructive, depending on the stage of evolution of cerebral ischemic damage.
Conclusions
We have demonstrated that transient focal ischemia is followed by expression of iNOS mRNA in the postischemic brain. iNOS expression peaks at 12 hours and is localized predominantly to vascular cells in the region of the infarct. The temporal profile and cellular localization of the expression differ from those previously reported in permanent focal ischemia. Treatment with the iNOS inhibitor AG reduces the extent of the tissue damage. The data suggest that although iNOS expression occurs both in permanent and transient ischemia, the temporal profile and cellular localization of the expression depend on the characteristics of the ischemic challenge. Thus, postischemic iNOS expression in brain differs from inflammation-induced iNOS expression in other systems in that the response is not stereotyped but rather depends on the nature of the ischemic insult. Whatever the characteristics of postischemic iNOS expression, the data add further support to the hypothesis that iNOS expression is an important determinant of ischemic brain damage.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received February 12, 1996; revision received April 18, 1996; accepted May 16, 1996.
| References |
|---|
|
|
|---|
2. Garcia JH, Liu KF, Yoshida Y, Lian J, Chen S, del Zoppo G. Influx of leukocytes and platelets in an evolving brain infarct. Am J Pathol. 1994;144:188-199.[Abstract]
3.
Pozzilli C, Lenzi GL, Argentino C, Carolei A, Rasura M, Signore A, Bozzao L, Pozzilli P. Imaging of leukocytic infiltration in human cerebral infarcts. Stroke. 1985;16:251-255.
4. Zhang RL, Chopp M, Chen H, Garcia JH. Temporal profile of ischemic tissue damage, neutrophil response, and vascular plugging following permanent and transient (2H) middle cerebral artery occlusion in the rat. J Neurol Sci. 1994;125:3-10.[Medline] [Order article via Infotrieve]
5. Matsuo Y, Onodera H, Shiga Y, Nakamura M, Ninomiya M, Kihara T, Kogure K. Correlation between myeloperoxidase-quantified neutrophil accumulation and ischemia brain injury in the rat. Stroke. 1994;25:1469-1475.[Abstract]
6. Clark RK, Lee EV, Fish CJ, White RF, Price WJ, Jonak ZL, Feuerstein GZ. Development of tissue damage, inflammation and resolution following stroke: an immunohistochemical and quantitative planimetric study. Brain Res Bull. 1993;31:565-572.[Medline] [Order article via Infotrieve]
7. Garcia JH, Yoshida Y, Chen H, Li Y, Zhang ZG, Lian J, Chen S, Chopp M. Progression from ischemic injury to infarct following middle cerebral artery occlusion in the rat. Am J Pathol. 1993;142:623-635.[Abstract]
8. Jorgensen MB, Finsen BR, Jensen MB, Castellano B, Diemer NH, Zimmer J. Microglial and astroglial reactions to ischemic and kainic acid-induced lesions of the adult rat hippocampus. Exp Neurol. 1993;120:70-88.[Medline] [Order article via Infotrieve]
9. Chen M, Chopp M, Bodzin G. Neutropenia reduces the volume of cerebral infarct after transient middle cerebral artery occlusion in the rat. Neurosci Res Commun. 1992;11:93-99.
10.
Bowes MP, Rothlein R, Fagan SC, Zivin JA. Monoclonal antibodies preventing leukocyte activation reduce experimental neurologic injury and enhance efficacy of thrombolytic therapy. Neurology. 1995;45:815-819.
11. Chopp M, Zhang RL, Chen H, Li Y, Jiang N, Rusche JR. Postischemic administration of an antiMac-1 antibody reduces ischemic cell damage after transient middle cerebral artery occlusion in rats. Stroke. 1994;25:869-875.[Abstract]
12.
Clark WM, Madden KP, Rothlein R, Zivin JA. Reduction of central nervous system ischemic injury in rabbits using leukocyte adhesion antibody treatment. Stroke. 1991;22:877-883.
13.
Zhang RL, Chopp M, Li Y, Zaloga C, Jiang N, Jones ML, Miyasaka M, Ward PA. Anti-ICAM-1 antibody reduces ischemic cell damage after transient middle cerebral artery occlusion in the rat. Neurology. 1994;44:1747-1751.
14. Rothwell NJ, Relton JK. Involvement of interleukin-1 and lipocortin-1 in ischaemic brain damage. Cerebrovasc Brain Metab Rev. 1993;5:178-198.[Medline] [Order article via Infotrieve]
15. Feuerstein GZ, Liu T, Barone FC. Cytokines, inflammation, and brain injury: role of tumor necrosis factor-alpha. Cerebrovasc Brain Metab Rev. 1994;6:341-360.[Medline] [Order article via Infotrieve]
16.
Kochanek PM, Hallenbeck JM. Polymorphonuclear leukocytes and monocyte/macrophages in the pathogenesis of cerebral ischemia and stroke. Stroke. 1992;23:1367-1379.
17. Gross SS, Wolin MS. Nitric oxide: pathophysiological mechanisms. Annu Rev Physiol. 1995;57:737-769.[Medline] [Order article via Infotrieve]
18. Griffith OW, Stuehr DJ. Nitric oxide synthases: properties and catalytic mechanism. Annu Rev Physiol. 1995;57:707-736.[Medline] [Order article via Infotrieve]
19. Iadecola C, Xu X, Zhang F, El-Fakahany EE, Ross ME. Marked induction of calcium-independent nitric oxide synthase activity after focal cerebral ischemia. J Cereb Blood Flow Metab. 1995;14:52-59.
20. Iadecola C, Zhang F, Xu X, Casey R, Ross ME. Inducible nitric oxide synthase gene expression in brain following focal cerebral ischemia. J Cereb Blood Flow Metab. 1995;15:378-384.[Medline] [Order article via Infotrieve]
21.
Iadecola C, Zhang F, Xu X. Inhibition of inducible nitric oxide synthase ameliorates cerebral ischemic damage. Am J Physiol. 1995;268:R286-R292.
22. Fieschi C, Argentino C, Lenzi GL, Sacchetti ML, Toni D, Bozzao L. Clinical and instrumental evaluation of patients with ischemic stroke within the first six hours. J Neurol Sci. 1989;91:311-322.[Medline] [Order article via Infotrieve]
23.
Zhang F, Casey R, Ross ME, Iadecola C. Aminoguanidine ameliorates and L-arginine worsens brain damage from intraluminal middle cerebral artery occlusion. Stroke. 1996;27:317-323.
24. Ross ME, Iadecola C. Nitric oxide synthase expression in cerebral ischemia: neurochemical, immunocytochemical and molecular approaches. Methods Enzymol. 1996;269:408-426.[Medline] [Order article via Infotrieve]
25. Zhang F, White JG, Iadecola C. Nitric oxide donors increase blood flow and reduce brain damage in focal ischemia: evidence that nitric oxide is beneficial in the early stages of cerebral ischemia. J Cereb Blood Flow Metab. 1994;14:217-226.[Medline] [Order article via Infotrieve]
26.
Zea Longa E, Weinstein PR, Carlson S, Cummins R. Reversible middle cerebral artery occlusion without craniectomy in rat. Stroke. 1989;20:84-91.
27. Chomczynski P, Sacchi N. Single-step method for RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]
28.
Lin TN, He YY, Wu G, Khan M, Hsu CY. Effect of brain edema on infarct volume in a focal cerebral ischemia model in rats. Stroke. 1993;24:117-121.
29. Takeshima R, Kirsch JR, Koehler RC, Traystman RJ. Tirilazad treatment does not decrease early brain injury after transient focal ischemia in cats. Stroke. 1994;25:670-676.[Abstract]
30. Zhao Q, Memezawa H, Smith M-L, Siesjo BK. Hyperthermia complicates middle cerebral artery occlusion induced by an intraluminal filament. Brain Res. 1994;649:253-259.[Medline] [Order article via Infotrieve]
31.
Lorsbach RB, Murphy WJ, Lowenstein CJ, Snyder SH, Russell SW. Expression of the nitric oxide synthase gene in mouse macrophages activated for tumor cell killing: molecular basis for the synergy between interferon-gamma and lipopolysaccharide. J Biol Chem. 1993;268:1908-1913.
32. Nathan C, Xie QW. Nitric oxide synthetases: roles, tolls and controls. Cell. 1994;78:915-918.[Medline] [Order article via Infotrieve]
33.
Kamijo R, Harada H, Matsuyama T, Bosland M, Gerecitano J, Shapiro D, Le J, Koh SI, Kimura T, Green SJ, Mak TW, Taniguchi T, Vilcek J. Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science. 1994;263:1612-1615.
34.
Xie QW, Kashiwabara Y, Nathan C. Role of transcription factor NF-kappa B/Rel in induction of nitric oxide synthase. J Biol Chem. 1994;269:4705-4708.
35.
Martin E, Nathan C, Xie QW. Role of interferon regulatory factor 1 in induction of nitric oxide synthase. J Exp Med. 1994;180:977-984.
36.
Liu T, McDonnell PC, Young PR, White RF, Siren AL, Hallenbeck JM, Barone FC, Feuerstein GZ. Interleukin-1ß mRNA expression in ischemic rat cortex. Stroke. 1993;24:1746-1750.
37.
Liu T, Clark RK, McDonnell PC, Young PR, White RF, Barone FC, Feuerstein GZ. Tumor necrosis factor-
expression in ischemic neurons. Stroke. 1994;25:1481-1488.[Abstract]
38. Wang X, Yue TL, Young PR, Barone FC, Feuerstein GZ. Expression of interleukin-6, c-fos, and zif268 mRNAs in rat ischemic cortex. J Cereb Blood Flow Metab. 1995;15:166-171.[Medline] [Order article via Infotrieve]
39. Nunokawa Y, Ishida N, Tanaka S. Promoter analysis of human inducible nitric oxide synthase gene associated with cardiovascular homeostasis. Biochem Biophys Res Commun. 1994;200:802-807.[Medline] [Order article via Infotrieve]
40.
Wang X, Yue TL, Barone FC, Feuerstein GZ. Monocyte chemoattractant protein-1 messenger RNA expression in rat ischemic cortex. Stroke. 1995;26:661-665.
41. Adcock IM, Brown CR, Kwon O, Barnes PJ. Oxidative stress induces NF kappa B DNA binding and inducible NOS mRNA in human epithelial cells. Biochem Biophys Res Commun. 1994;199:1518-1524.[Medline] [Order article via Infotrieve]
42. Hossmann K-A. Hemodynamics of postischemic reperfusion of the brain. In: Weinstein PR, Faden AI, eds. Protection of the Brain From Ischemia. Baltimore, Md: Williams & Wilkins; 1983:21-36.
43.
Prado R, Watson BD, Kuluz J, Dietrich WD. Endothelium-derived nitric oxide synthase inhibition: effects on cerebral blood flow, pial artery diameter, and vascular morphology in rats. Stroke. 1992;23:1118-1123.
44.
Beckman JS, Beckman TW, Chen J, Marshall PA, Freeman BA. Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide. Proc Natl Acad Sci U S A. 1990;87:1620-1624.
45. Morikawa E, Rosenblatt S, Moskowitz MA. L-arginine dilates rat pial arterioles by nitric oxide-dependent mechanisms and increases blood flow during focal cerebral ischaemia. Br J Pharmacol. 1992;107:905-907.[Medline] [Order article via Infotrieve]
46. Zhang F, Iadecola C. Reduction of focal cerebral ischemic damage by delayed treatment with nitric oxide donors. J Cereb Blood Flow Metab. 1994;14:574-580.[Medline] [Order article via Infotrieve]
47. Zhang F, Xu X, Iadecola C. Time-dependence of the effect of nitric oxide synthase inhibition on cerebral ischemic damage. J Cereb Blood Flow Metab. 1995;15:595-601.[Medline] [Order article via Infotrieve]
48.
Huang A, Huang PL, Panahian N, Dalkara T, Fishman MC, Moskowitz MA. Effects of cerebral ischemia in mice deficient in neuronal nitric oxide synthase. Science. 1994;265:1883-1885.
Division of Cardiology, Medical College of Virginia, Richmond Va
| Introduction |
|---|
|
|
|---|
NO is synthesized from various forms of an unusual enzyme called NO synthase (NOS) which is homologous to cytochrome P450 reductase.1R A single cell may have two kinds of the enzyme, a constitutive and inducible, which produce NO for different roles. Constitutive enzymes are always present in the cells and generate brief puffs of NO for tasks like neurotransmission. In contrast, inducible enzymes are goaded into action more slowly by other cellular messengers. Over a period of days they can produce at least 1000 times more NO for cellular defense. Current views hold that there is successive activation of two O2 molecules as a means to insert a pair of oxygen atoms into an arginine substrate, thus yielding NO and citrulline.2R
In this article, Iadecola et al studied the expression of iNOS after transient cerebral ischemia in rats, a model closely related to the transient ischemic insult that is known to occur in human stroke. Their data clearly show that iNOS mRNA peaked at 12 hours after transient ischemia. The immunocytochemical studies demonstrate that iNOS expression was mainly localized in the vascular cells in the region of the infarct. A noteworthy feature of this study is that treatment with the iNOS inhibitor AG reduced the extent of tissue damage, demonstrating that expression of this enzyme during transient ischemia is an important determinant of ischemic brain damage.
| Selected Abbreviations and Acronyms |
|---|
|
Values are mean±SE.
*P<.05 from saline; t test.
| References |
|---|
|
|
|---|
2R.
Leone AM. Constitutive and inducible nitric oxide synthases incorporate molecular oxygen into both nitric oxide and citrulline. J Biol Chem.. 1991;266:23790-23795.
This article has been cited by other articles:
![]() |
F. Boscia, R. Gala, A. Pannaccione, A. Secondo, A. Scorziello, G. Di Renzo, and L. Annunziato NCX1 Expression and Functional Activity Increase in Microglia Invading the Infarct Core Stroke, November 1, 2009; 40(11): 3608 - 3617. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Pacher, J. S. Beckman, and L. Liaudet Nitric Oxide and Peroxynitrite in Health and Disease Physiol Rev, January 1, 2007; 87(1): 315 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Anttila, H. Christou, I. Hagino, Y. Iwata, B. A. Mettler, A. Fernandez-Gonzalez, D. Zurakowski, and R. A. Jonas Cerebral Endothelial Nitric Oxide Synthase Expression is Reduced After Very Low Flow Bypass Ann. Thorac. Surg., June 1, 2006; 81(6): 2202 - 2206. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. L. Ma, X. Zhu, P. M. Rivera, O. Toien, B. M. Barnes, J. C. LaManna, M. A. Smith, and K. L. Drew Absence of cellular stress in brain after hypoxia induced by arousal from hibernation in Arctic ground squirrels Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2005; 289(5): R1297 - R1306. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lazovic, A. Basu, H.-W. Lin, R. P. Rothstein, J. K. Krady, M. B. Smith, and S. W. Levison Neuroinflammation and Both Cytotoxic and Vasogenic Edema Are Reduced in Interleukin-1 Type 1 Receptor-Deficient Mice Conferring Neuroprotection Stroke, October 1, 2005; 36(10): 2226 - 2231. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.A. Gunnett, D.D. Lund, A.K. McDowell, F.M. Faraci, and D.D. Heistad Mechanisms of Inducible Nitric Oxide Synthase-Mediated Vascular Dysfunction Arterioscler Thromb Vasc Biol, August 1, 2005; 25(8): 1617 - 1622. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Goyagi, T. J.K. Toung, J. R. Kirsch, R. J. Traystman, R. C. Koehler, P. D. Hurn, and A. Bhardwaj Neuroprotective {kappa}-Opioid Receptor Agonist BRL 52537 Attenuates Ischemia-Evoked Nitric Oxide Production In Vivo in Rats Stroke, June 1, 2003; 34(6): 1533 - 1538. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Eguchi, L. V. d'Uscio, C. Wambi, D. Weiler, I. Kovesdi, T. O'Brien, and Z. S. Katusic Inhibitory effect of recombinant iNOS gene expression on vasomotor function of canine basilar artery Am J Physiol Heart Circ Physiol, December 1, 2002; 283(6): H2560 - H2566. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Veltkamp, N. Rajapakse, G. Robins, M. Puskar, K. Shimizu, and D. Busija Transient Focal Ischemia Increases Endothelial Nitric Oxide Synthase in Cerebral Blood Vessels Stroke, November 1, 2002; 33(11): 2704 - 2710. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.A. Gunnett, D.D. Lund, M.A. Howard III, Y. Chu, F.M. Faraci, and D.D. Heistad Gene Transfer of Inducible Nitric Oxide Synthase Impairs Relaxation in Human and Rabbit Cerebral Arteries Stroke, September 1, 2002; 33(9): 2292 - 2296. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Gunnett, D. D. Lund, Y. Chu, R. M. Brooks II, F. M. Faraci, and D. D. Heistad NO-Dependent Vasorelaxation Is Impaired After Gene Transfer of Inducible NO-Synthase Arterioscler Thromb Vasc Biol, August 1, 2001; 21(8): 1281 - 1287. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Stella, A. Vercelli, M. Repici, A. Follenzi, and P. M. Comoglio Macrophage Stimulating Protein Is a Novel Neurotrophic Factor Mol. Biol. Cell, May 1, 2001; 12(5): 1341 - 1352. [Abstract] [Full Text] |
||||
![]() |
C. Iadecola, K. Niwa, S. Nogawa, X. Zhao, M. Nagayama, E. Araki, S. Morham, and M. E. Ross Reduced susceptibility to ischemic brain injury and N-methyl-D-aspartate-mediated neurotoxicity in cyclooxygenase-2-deficient mice PNAS, January 30, 2001; 98(3): 1294 - 1299. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takano, X.-L. Tang, E. Kodani, and R. Bolli Late preconditioning enhances recovery of myocardial function after infarction in conscious rabbits Am J Physiol Heart Circ Physiol, November 1, 2000; 279(5): H2372 - H2381. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu, L. He, S. H. Ahmed, S.-W. Chen, M. P. Goldberg, J. S. Beckman, C. Y. Hsu, and C. Iadecola Oxygen-Glucose Deprivation Induces Inducible Nitric Oxide Synthase and Nitrotyrosine Expression in Cerebral Endothelial Cells Editorial Comment Stroke, July 1, 2000; 31(7): 1744 - 1751. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Castillo, R. Rama, and A. Davalos Nitric Oxide-Related Brain Damage in Acute Ischemic Stroke Stroke, April 1, 2000; 31(4): 852 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shareef, A. Sawada, and A. H. Neufeld Isoforms of Nitric Oxide Synthase in the Optic Nerves of Rat Eyes with Chronic Moderately Elevated Intraocular Pressure Invest. Ophthalmol. Vis. Sci., November 1, 1999; 40(12): 2884 - 2891. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lipton Ischemic Cell Death in Brain Neurons Physiol Rev, October 1, 1999; 79(4): 1431 - 1568. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Davis and D. Barer Neuroprotection in acute ischaemic stroke. II: Clinical potential Vascular Medicine, August 1, 1999; 4(3): 149 - 163. [Abstract] [PDF] |
||||
![]() |
C. Iadecola, C. A. Salkowski, F. Zhang, T. Aber, M. Nagayama, S. N. Vogel, and M. Elizabeth Ross The Transcription Factor Interferon Regulatory Factor 1 Is Expressed after Cerebral Ischemia and Contributes to Ischemic Brain Injury J. Exp. Med., February 15, 1999; 189(4): 719 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cho, B. T. Volpe, Y. Bae, O. Hwang, H. J. Choi, J. Gal, L. C. H. Park, C. K. Chu, J. Du, and T. H. Joh Blockade of Tetrahydrobiopterin Synthesis Protects Neurons after Transient Forebrain Ischemia in Rat: A Novel Role for the Cofactor J. Neurosci., February 1, 1999; 19(3): 878 - 889. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Marrelli, A. Khorovets, T. D. Johnson, W. F. Childres, and R. M. Bryan Jr. P2 purinoceptor-mediated dilations in the rat middle cerebral artery after ischemia-reperfusion Am J Physiol Heart Circ Physiol, January 1, 1999; 276(1): H33 - H41. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Galea, S. B. Glickstein, D. L. Feinstein, E. V. Golanov, and D. J. Reis Stimulation of cerebellar fastigial nucleus inhibits interleukin-1beta -induced cerebrovascular inflammation Am J Physiol Heart Circ Physiol, December 1, 1998; 275(6): H2053 - H2063. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nogawa, C. Forster, F. Zhang, M. Nagayama, M. E. Ross, and C. Iadecola Interaction between inducible nitric oxide synthase and cyclooxygenase-2 after cerebral ischemia PNAS, September 1, 1998; 95(18): 10966 - 10971. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Y. Calingasan, L. C. H. Park, L. L. Calo, R. R. Trifiletti, S. E. Gandy, and G. E. Gibson Induction of Nitric Oxide Synthase and Microglial Responses Precede Selective Cell Death Induced by Chronic Impairment of Oxidative Metabolism Am. J. Pathol., August 1, 1998; 153(2): 599 - 610. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Galea, E. V. Golanov, D. L. Feinstein, K. A. Kobylarz, S. B. Glickstein, and D. J. Reis Cerebellar stimulation reduces inducible nitric oxide synthase expression and protects brain from ischemia Am J Physiol Heart Circ Physiol, June 1, 1998; 274(6): H2035 - H2045. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, C. Louden, T.-L. Yue, J. A. Ellison, F. C. Barone, H. A. Solleveld, and G. Z. Feuerstein Delayed Expression of Osteopontin after Focal Stroke in the Rat J. Neurosci., March 15, 1998; 18(6): 2075 - 2083. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. FARACI and D. D. HEISTAD Regulation of the Cerebral Circulation: Role of Endothelium and Potassium Channels Physiol Rev, January 1, 1998; 78(1): 53 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Iadecola, F. Zhang, R. Casey, M. Nagayama, and M. E. Ross Delayed Reduction of Ischemic Brain Injury and Neurological Deficits in Mice Lacking the Inducible Nitric Oxide Synthase Gene J. Neurosci., December 1, 1997; 17(23): 9157 - 9164. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nogawa, F. Zhang, M. E. Ross, and C. Iadecola Cyclo-Oxygenase-2 Gene Expression in Neurons Contributes to Ischemic Brain Damage J. Neurosci., April 15, 1997; 17(8): 2746 - 2755. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Stroke Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1996 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |