This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Maeda, Y. Articles by Shimada, K. Search for Related Content PubMed PubMed Citation Articles by Maeda, Y. Articles by Shimada, K.

(Stroke. 1996;27:1521-1523.)
© 1996 American Heart Association, Inc.

Articles

Angiotensin-Converting Enzyme Gene Polymorphism in Hypertensive Individuals With Parental History of Stroke

Yoshikazu Maeda, MD; Uichi Ikeda, MD; Hitoshi Ebata, MD; Yukihiro Hojo, MD; Yoshitane Seino, MD; Yuji Hayashi, MD; Shigehiro Kuroki, MD Kazuyuki Shimada, MD

the Department of Cardiology, Jichi Medical School, Minamikawachi, Tochigi, Japan.

Correspondence to Uichi Ikeda, MD, Department of Cardiology, Jichi Medical School, Minamikawachi, Tochigi 329-04, Japan. E-mail uikeda@jichi.ac.jp.

	Abstract

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Background and Purpose It has been suggested that the insertion (I)/deletion (D) polymorphism of the angiotensin-converting enzyme (ACE) gene is an independent risk factor for coronary artery disease, but its relation to stroke has not yet been proven. We investigated an association of ACE gene polymorphism with parental history of stroke (PHS) in patients with hypertension.

Methods We studied 70 hypertensive patients (ambulatory blood pressure >140/90 mm Hg; age, 59±11 years) with (n=27) or without (n=43) PHS, defined as either one or both parents having had a stroke before 60 years of age. The ACE genotype was analyzed by polymerase chain reaction.

Results Casual blood pressure and mean ambulatory blood pressure levels were not significantly different between patients with and without PHS. The incidence of left ventricular hypertrophy also did not differ significantly between the two groups. However, the frequency of the D allele was significantly higher in patients with PHS (0.72) than in patients without PHS (0.52) (²=5.472, P=.019). The frequency of the DD genotype of the ACE gene was also significantly higher in patients with than in those without PHS (DD, 63.0%; ID, 18.5%; II, 18.5% versus DD, 32.6%; ID, 39.5%; II, 27.9%; ²=6.395, P=.041).

Conclusions The DD genotype of the ACE gene is associated with PHS in patients with hypertension, which is independent of blood pressure levels or presence of cardiac hypertrophy.

Key Words: angiotensin-converting enzymes • genetics • hypertension • polymorphism (genetics)

	Introduction

Top Abstract Introduction Subjects and Methods Results Discussion References

 
A deletion polymorphism in the gene encoding ACE (EC 3.4.15.1) is strongly related to the levels of the circulating enzyme.¹ It may be a potent risk factor for myocardial infarction, especially in people otherwise classified as low risk (nonobese subjects with normal lipid values).² This polymorphism is also associated with a parental history of myocardial infarction in the same population.^{3 4} In addition, this ACE gene variant is associated with the pathogenesis of ischemic and idiopathic dilated cardiomyopathies.⁵ Through its roles in the conversion of angiotensin I to angiotensin II and in the inactivation of kinins, ACE may modulate cardiovascular growth.⁶ This is the rationale underlying the recently reported association of the DD genotype with intima-media thickening of common carotid arteries⁷ as well as left ventricular hypertrophy^{8 9} and hypertrophic cardiomyopathy.¹⁰

There are similarities in the pathophysiology of cerebral and myocardial infarction. Both commonly result from thrombosis superimposed on atherosclerotic plaques. The ACE gene may thus be a candidate gene involved not only in cardiovascular disease but also in stroke, although there have been only a few previous reports on their relation.^{11 12} If the frequency of the DD genotype was also increased in stroke, those affected would transmit the D allele to their offspring more often than unaffected parents, and both DD and ID genotypes would be expected to be more frequent in those with a PHS. Thus, in this study we investigated an association of the ACE I/D genotype with PHS in patients with hypertension.

	Subjects and Methods

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Subjects
We investigated 70 hypertensive patients without ischemic heart disease and diabetes mellitus (33 men, 37 women; mean age, 59±11 years). All patients were examined consecutively in our outpatient department. Diagnosis of hypertension was based on casual systolic blood pressure exceeding 140 mm Hg and/or diastolic blood pressure exceeding 90 mm Hg. To exclude so-called white coat hypertension, ABP monitoring was also performed, and patients whose 24-hour ABP did not exceed 140 mm Hg systolic and/or 90 mm Hg diastolic were excluded.

Using a sphygmomanometer on at least three separate occasions in the physician's office, we measured casual blood pressures with subjects in a sitting position after they rested for 10 minutes. The ABP of each subject was monitored noninvasively from the right or left arm to record the blood pressure with a TM-2421 ABP monitoring system (A&D Co). Recording was started at 9 AM, programmed every 30 minutes, and finished at 10 AM on the following day. The two 30-minute recordings obtained during the initial 60-minute period were excluded from the analysis.

A standard 12-lead electrocardiogram was recorded at rest in all patients and analyzed with a digital system. Left ventricular hypertrophy was defined according to the criteria of Sokolow and Lyon.¹³ Subjects with evidence of bundle-branch block or Wolff-Parkinson-White syndrome were excluded from the analysis.

The presence or absence of family history of stroke, ischemic heart disease, and diabetes mellitus was carefully investigated by medical history, electrocardiography, and blood analysis. PHS was regarded as positive if one or both parents had an apparent history of cerebrovascular accident before 60 years of age.

Analysis of ACE Genotype
Peripheral venous blood samples (3 mL) were drawn, and high-molecular-weight DNA was isolated from peripheral blood leukocytes with a DNA extraction kit (QIAamp blood kit; QIAGEN Inc). PCR was performed in a final volume of 100 µL in a mixture containing 1 µg genomic DNA, 100 pmol of each primer, 3 mmol/L MgCl₂, 50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.4, and 0.5 U of Taq polymerase (Perkin Elmer Cetus). The sense primer was 5' CTGGAGACCACTCCCATCCTTTCT 3', and the antisense primer was 5' GATGTGGCCATCACATTCGTCAGAT 3'.¹⁴ Amplification was performed in a Thermal Cycler (Hoei) for 45 cycles with steps of denaturation at 94°C for 1 minute, annealing at 58°C for 2 minutes, and extension at 72°C for 1 minute. PCR products were electrophoresed in 3% agarose gels and were visualized by ethidium bromide staining.

Statistical Analysis
Values are expressed as mean±SD. Allele frequencies were deduced from genotype frequencies. Differences in allele and genotype frequencies between groups and Hardy-Weinberg equilibrium were tested by ² test. Differences in variables of risk factors between groups were assessed by Student's t test. A value of P<.05 was considered statistically significant.

	Results

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Clinical parameters, age, sex, body mass index, and smoking are listed in Table 1. No significant differences were detected between the hypertensive patients with and without PHS. Incidences of left ventricular hypertrophy, casual blood pressure, and mean ABP levels were also not significantly different between the two groups.

View this table: [in this window] [in a new window]   Table 1. Clinical Parameters of the Patient Population

The ACE polymorphism detected by PCR was evident as a 490-bp product in the presence of the insertion (I allele) and as a 190-bp fragment in the absence of the insertion (D allele). Thus, each DNA sample revealed one of three possible patterns after electrophoresis: a 490-bp band (genotype II), a 190-bp band (genotype DD), or both a 490-bp and a 190-bp band (genotype ID). ACE genotypes and derived allele frequencies are shown in Table 2. The frequency of the D allele was significantly higher in patients with PHS (0.72) than in those without PHS (0.52). The frequency of the DD genotype was also significantly higher in patients with than in those without PHS (DD, 63.0%; ID, 18.5%; II, 18.5% versus DD, 32.6%; ID, 39.5%; II, 27.9%; ²=6.395, P=.041). There was no deviation in genotype frequencies from those predicted by Hardy-Weinberg law in patients with and without PHS (²=3.826, P=.148 and ²=0.757, P=.685, respectively).

View this table: [in this window] [in a new window]   Table 2. PHS and ACE Genotype and Allele Frequencies

Most previous studies have shown that hypertension itself is not associated with the ACE genotype,^{15 16} although contrasting results were also reported.¹⁷ In the present study the casual blood pressure levels and mean ABP levels were not significantly different among the ACE genotypes in patients with hypertension (Table 3).

View this table: [in this window] [in a new window]   Table 3. ACE Genotype and Blood Pressure

	Discussion

Top Abstract Introduction Subjects and Methods Results Discussion References

 
This study was designed to determine whether the ACE DD polymorphism is common in hypertensive patients with PHS. There were no differences in accepted risk factors between the two groups with or without PHS. Casual blood pressure and mean ABP levels were also not significantly different between the two groups. However, the frequencies of the DD genotype and D allele of the ACE gene were significantly higher in patients with than in those without PHS.

We found a few previous reports regarding the association between ACE gene polymorphism and stroke. Sharma et al¹¹ reported that there was no association between ACE gene polymorphism and stroke, although there was a tendency for stroke to occur at a younger age in subjects with the DD genotype. On the other hand, very recently Markus et al¹² reported that the DD genotype of the ACE gene was an independent risk factor for lacunar stroke. Morris et al¹⁸ revealed that the DD genotype increased risk of premature death in hypertensive subjects who had two hypertensive parents. Ueda et al¹⁹ also observed a weak association between the DD genotype and stroke in patients with hypertension. These observations may be compatible with our results that the DD genotype is associated with PHS in patients with hypertension.

In a large clinical trial, the treatment of hypertension was associated with a marked decrease in stroke morbidity and mortality rates.²⁰ On the other hand, in stroke-prone spontaneously hypertensive rats, long-term treatment with an ACE inhibitor at a reduced dose that did not reduce blood pressure levels decreased stroke-related mortality.²¹ Thus, the protective effects of the ACE inhibitor may be mediated by a mechanism other than blood pressure reduction. One possible mechanism is inhibition of the local renin-angiotensin system, which may contribute to cerebral vascular wall damage. Previous studies have demonstrated that circulating ACE activity¹ and ACE activity in myocardial tissue²² and T cells²³ from individuals with the DD genotype are higher than those from individuals with the II or ID genotype. Therefore, it is speculated that ACE activity in cerebral vascular tissues might be higher in the DD genotype than in the II or ID genotype, and higher ACE activity might lead to higher angiotensin II formation in situ, which might stimulate vascular smooth muscle proliferation and extracellular matrix formation.

In many previous studies, hypertension itself was not associated with ACE genotype.^{15 16} These investigators compared casual blood pressure levels and ACE genotype. In the present study ABP levels as well as casual blood pressure levels were also not correlated with ACE genotype in hypertensive patients. However, the frequency of the DD genotype in 43 definite hypertensive patients without PHS (33%) was slightly higher than that in 30 normotensive control subjects (23%) in our population. Further studies to clarify the relationship between hypertension and the ACE genotype are currently under way in our laboratory.

Limitations of the Present Study
Our definition of PHS was according to patients' family history taking. An important consideration in this study is the accuracy of the self-reported family history questionnaire, and it is not clear whether the parents had cerebral infarction, hemorrhage, or embolism, although detailed medical histories were ascertained from patients and families. In addition, the parents with stroke were not genotyped, and the individuals in the present study had not had stroke. Furthermore, we did not measure plasma ACE levels in the individuals, although the DD genotype has been shown to be associated with higher concentrations of circulating ACE activity in Japanese persons²⁴ as well as in whites.²

In conclusion, we found a significant increase in the incidence of the ACE DD genotype in hypertensive patients with PHS, which was independent of blood pressure levels or presence of cardiac hypertrophy. However, the exact relationship between the DD genotype and stroke in hypertensive individuals remains to be determined in larger case-control studies.

	Selected Abbreviations and Acronyms

 

ABP = ambulatory blood pressure ACE = angiotensin-converting enzyme D = deletion EC = Enzyme Commission of the International Union of Biochemistry I = insertion PCR = polymerase chain reaction PHS = parental history of stroke

	Acknowledgments

 
This study was supported by the Ministry of Education, Science, Sports, and Culture of Japan (5670632, 8670821).

Received February 1, 1996; revision received May 15, 1996; accepted May 15, 1996.

	References

Top Abstract Introduction Subjects and Methods Results Discussion References

 

1. Rigat B, Hubert C, Alhenc GF, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990;86:1343-1346.
2. Cambien F, Poirier O, Lecerf L, Evans A, Cambou JP, Arveiler D, Luc G, Bard JM, Bara L, Ricard S, Tiret L, Amouyel P, Alhenc-Gelas F, Soubrier F. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature. 1992;359:641-644.[Medline] [Order article via Infotrieve]
3. Tiret L, Kee F, Poirier O, Nicaud V, Lecerf L, Evans A, Cambou JP, Arveiler D, Luc G, Amouyel P, Cambien F. Deletion polymorphism in angiotensin-converting enzyme gene associated with parental history of myocardial infarction. Lancet. 1993;341:991-992.[Medline] [Order article via Infotrieve]
4. Badenhop RF, Wang XL, Wilcken DE. Angiotensin-converting enzyme genotype in children and coronary events in their grandparents. Circulation. 1995;91:1655-1658.[Abstract/Free Full Text]
5. Raynolds MV, Bristow MR, Bush EW, Abraham WT, Lowes BD, Zisman LS, Taft CS, Perryman MB. Angiotensin-converting enzyme DD genotype in patients with ischaemic or idiopathic dilated cardiomyopathy. Lancet. 1993;342:1073-1075.[Medline] [Order article via Infotrieve]
6. Schelling P, Fischer H, Ganten D. Angiotensin and cell growth: a link to cardiovascular hypertrophy? J Hypertens. 1991;9:3-15.[Medline] [Order article via Infotrieve]
7. Castellano M, Muiesan ML, Rizzoni D, Beschi M, Pasini G, Cinelli A, Salvetti M, Porteri E, Bettoni G, Kreutz R, Lindpaintner K, Rosei EA. Angiotensin-converting enzyme I/D polymorphism and arterial wall thickness in a general population: the Vobarno Study. Circulation. 1995;91:2721-2724.[Abstract/Free Full Text]
8. Schunkert H, Hense HW, Holmer SR, Stender M, Perz S, Keil U, Lorell BH, Riegger GA. Association between a deletion polymorphism of the angiotensin-converting-enzyme gene and left ventricular hypertrophy. N Engl J Med. 1994;330:1634-1638.[Abstract/Free Full Text]
9. Iwai N, Ohmichi N, Nakamura Y, Kinoshita M. DD genotype of the angiotensin-converting enzyme gene is a risk factor for left ventricular hypertrophy. Circulation. 1994;90:2622-2628.[Abstract/Free Full Text]
10. Marian AJ, Yu QT, Workman R, Greve G, Roberts R. Angiotensin-converting enzyme polymorphism in hypertrophic cardiomyopathy and sudden cardiac death. Lancet. 1993;342:1085-1086.[Medline] [Order article via Infotrieve]
11. Sharma P, Carter ND, Barley J, Brown MM. Molecular approach to assessing the genetic risk of cerebral infarction: deletion polymorphism in the gene encoding angiotensin 1-converting enzyme. J Hum Hypertens. 1994;8:645-648.[Medline] [Order article via Infotrieve]
12. Markus HS, Barley J, Lunt R, Bland JM, Jeffery S, Carter ND, Brown MM. Angiotensin-converting enzyme gene deletion polymorphism: a new risk factor for lacunar stroke but not carotid atheroma. Stroke. 1995;26:1329-1333.[Abstract/Free Full Text]
13. Sokolow M, Lyon TP. The ventricular complex in left ventricular hypertrophy as obtained by unipolar precordial and limb leads. Am Heart J. 1949;62:161-186.
14. Rigat B, Hubert C, Corvol P, Soubrier F. PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic Acids Res. 1992;20:1433.[Free Full Text]
15. Schmidt S, van Hooft IMS, Grobbee DE, Ganten D, Ritz E. Polymorphism of the angiotensin I converting enzyme gene is apparently not related to high blood pressure: Dutch Hypertension and Offspring Study. J Hypertens. 1993;11:345-348.[Medline] [Order article via Infotrieve]
16. Higashimori K, Zhao Y, Higaki J, Kamitani A, Katsuya T, Nakura J, Miki T, Mikami H, Ogihara T. Association analysis of a polymorphism of the angiotensin converting enzyme gene with essential hypertension in the Japanese population. Biochem Biophys Res Commun. 1993;191:399-404.[Medline] [Order article via Infotrieve]
17. Zee RY, Lou YK, Griffiths LR, Morris BJ. Association of a polymorphism of the angiotensin I-converting enzyme gene with essential hypertension. Biochem Biophys Res Commun. 1992;184:9-15.[Medline] [Order article via Infotrieve]
18. Morris BJ, Zee RYL, Schrader AP. Different frequencies of angiotensin-converting enzyme genotypes in older hypertensive individuals. J Clin Invest. 1994;94:1085-1089.
19. Ueda S, Weir CJ, Inglis GC, Murray GD, Muir KW, Lees KR. Lack of association between angiotensin converting enzyme gene insertion/deletion polymorphism and stroke. J Hypertens. 1995;13:1597-1601.[Medline] [Order article via Infotrieve]
20. SHEP Cooperative Research Group. Prevention of stroke by antihypertensive drug treatment in older persons with isolated systolic hypertension: final results of the Systolic Hypertension in the Elderly Program (SHEP). JAMA. 1991;265:3255-3264.[Abstract]
21. Charles TS Jr, Ibrahim FB, Saleem A, Hailiu Z, Nicola S, Steven R, Seymour L, Harold DI. Enalapril prevents stroke and kidney dysfunction in salt-loaded stroke-prone spontaneously hypertensive rats. Hypertension. 1989;13:115-121.[Abstract/Free Full Text]
22. Danser AHJ, Schalekamp MADH, Bax WA, van den Brink AM, Saxena PR, Riegger GA. ACE in the human heart: effect of the deletion/insertion polymorphism. Circulation. 1995;92(suppl):I-29. Abstract.
23. Costerousse O, Allegrini J, Lopez M, Alhenc GF. Angiotensin I-converting enzyme in human circulating mononuclear cells: genetic polymorphism of expression in T-lymphocytes. Biochem J. 1993;290:33-40.
24. Nakai K, Itoh C, Miura Y, Hotta K, Musha T, Itoh T, Miyakawa T, Iwasaki R, Hiramori K. Deletion polymorphism of the angiotensin I-converting enzyme gene is associated with serum ACE concentration and increased risk for CAD in the Japanese. Circulation. 1994;90:2199-2202.[Abstract/Free Full Text]

This article has been cited by other articles:

				F.A. Sayed-Tabatabaei, B.A. Oostra, A. Isaacs, C.M. van Duijn, and J.C.M. Witteman ACE Polymorphisms Circ. Res., May 12, 2006; 98(9): 1123 - 1133. [Abstract] [Full Text] [PDF]

				A. Losito, K. Kalidas, S. Santoni, L. Ceccarelli, and S. Jeffery Polymorphism of renin-angiotensin system genes in dialysis patients--association with cerebrovascular disease Nephrol. Dial. Transplant., December 1, 2002; 17(12): 2184 - 2188. [Abstract] [Full Text] [PDF]

				M. Coutard, W. Huang, M. Osborne-Pellegrin, and H. A. Kontos Heritability of Intracerebral Hemorrhagic Lesions and Cerebral Aneurysms in the Rat Editorial Comment Stroke, November 1, 2000; 31(11): 2678 - 2684. [Abstract] [Full Text] [PDF]

				M. Pfohl, M. Koch, S. Prescod, K.K. Haase, H.U. Haring, and K.R. Karsch Angiotensin I-converting enzyme gene polymorphism, coronary artery disease and myocardial infarction. An angiographically controlled study Eur. Heart J., September 2, 1999; 20(18): 1318 - 1325. [Abstract] [PDF]

				R. Y.L. Zee, P. M. Ridker, M. J. Stampfer, C. H. Hennekens, and K. Lindpaintner Prospective Evaluation of the Angiotensin-Converting Enzyme Insertion/Deletion Polymorphism and the Risk of Stroke Circulation, January 26, 1999; 99(3): 340 - 343. [Abstract] [Full Text] [PDF]

				P. Sharma Meta-analysis of the ACE gene in ischaemic stroke J. Neurol. Neurosurg. Psychiatry, February 1, 1998; 64(2): 227 - 230. [Abstract] [Full Text] [PDF]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Maeda, Y. Articles by Shimada, K. Search for Related Content PubMed PubMed Citation Articles by Maeda, Y. Articles by Shimada, K.