(Stroke. 1998;29:388-398.)
© 1998 American Heart Association, Inc.
Relationship Between ApoE, MRI Findings, and Cognitive Function in the Cardiovascular Health Study
Lewis H. Kuller, MD, DrPH;
Lynn Shemanski, PhD;
Teri Manolio, MD, MHS;
Mary Haan, DrPH;
Linda Fried, MD, MPH;
Nick Bryan, MD, PhD;
Gregory L. Burke, MD, MS;
Russell Tracy, PhD;
Rafeeque Bhadelia, MD
From the University of Pittsburgh (Pa) (L.H.K.); CHS Coordinating Center,
Seattle, Wash (L.S.); NHLBI, Bethesda, Md (T.M., N.B.); University of
California-Davis (M.H.); Johns Hopkins Medical Institutions, Baltimore, Md
(L.F.); Bowman Gray School of Medicine, Winston-Salem, NC (G.L.B.); University
of Vermont, Colchester (R.T.); and CHS Ultrasound Laboratory, Tufts-New
England Medical Center, Boston, Mass (R.B.).
Correspondence to Dr Lewis H. Kuller, University of Pittsburgh, Department of Epidemiology, 130 DeSoto St, Pittsburgh, PA 15261. E-mail kuller+{at}pitt.edu
 |
Abstract
|
|---|
Background and PurposeWe determined
the relationship between apolipoprotein (Apo)E, MRI, and low
cognitive scores.
MethodsThe relationship between age, education, ApoE
genotype, MRI examination of the brain, subclinical and
clinical cardiovascular disease, and low (<80) score
on the Modified Mini-Mental State Examination (3MSE, as modified by
Teng and Chui) was evaluated for 3469 black and white participants in
the Cardiovascular Health Study (CHS) in years 5 and 6
of the study. The participants were followed for up to 3 years.
ResultsThe prevalence of scores <80 in years 5 and 6 of the CHS
was 8.2% for participants without and 20.4% for those with prior
history of stroke. Age, race, and education were important determinants
of low 3MSE scores. The prevalence of ApoE-4 (odds ratio [OR], 1.6
[1.1 to 2.1]) was directly related to scores <80, as was high
ventricular volume (OR, 1.6 [1.2 to 2.3]), high white
matter grade (OR, 1.4 [1.1 to 1.9]), and infarctlike lesions (OR, 1.6
[1.2 to 2.1]) on the MRI in the multivariate
analysis. A five-point or greater decline in scores over up to
3 years was more often observed for participants with low 3MSE scores
at year 5, at older ages, with lower education, and experiencing
incident stroke (OR, 3.6 [1.2 to 10.6]), ApoE-4 genotype (OR,
1.8 [1.4 to 2.3]), and with MRI findings of high
ventricular volume (OR, 2.0 [1.5 to 2.7]), and
infarctlike lesions (OR, 1.2 [0.9 to 1.5]).
ConclusionsThese results demonstrate that vascular changes on
MRI, measures of brain atrophy, ApoE-4, and age, education, and race
are associated with low cognitive scores among older individuals. The
MRI of the brain provides valuable information related to cognitive
tests and decline over time. The potential exists for using MRI
measurements to identify high-risk individuals for dementia and to test
potential interventions to reduce the risk of dementia.
Key Words: apolipoproteins dementia magnetic resonance imaging stroke vascular disease
 |
Introduction
|
|---|
In this report from
the CHS, we investigated (1) the association of ApoE genotype
with cognitive function as measured by the 3MSE (Teng et
al)1 2 ; (2) the association between ApoE-4 and
subclinical and clinical CVD at baseline with MRI findings at years 5
and 6 of the CHS and low score (<80) on 3MSE at years 5 or 7 of CHS;
and (3) the relationship between MRI findings and subclinical and
clinical cardiovascular disease, ApoE, incident
cardiovascular disease, and stroke after the MRI with
five-point or greater decrease in the 3MSE scores between years 5 and
7.3
The analyses are based on a very large population-based sample
of 3480 older black and white participants who had an MRI of the brain,
ApoE genotyping, assessment of incident stroke, MI, angina pectoris,
and CHF, and evaluation of subclinical CVD.
This report focuses on the interrelationship of age, race, education,
MRI findings, ApoE-4, low cognitive scores, and decline in scores over
3 years after the MRI in older adults.
Knowledge of the association of vascular disease and dementia has been
evolving with increasing use of cerebral MRI and CT, which have shown
that subclinical vascular pathology in the brain (such as "silent
infarction" and white matter changes) of probable vascular origins
may be associated with cognitive decline and
dementia.4 5 6 7
Improved survival of patients after a stroke and a growing population
of older individuals who are at higher risk of incident stroke suggest
that the number of cases of vascular dementia may increase in the
future. It is currently estimated that approximately 20% to 25% of
incident stroke cases subsequently become
demented.8 9 10 In addition, case-fatality rates
are higher among stroke patients who become demented than those who are
not demented.11
The neuronal cellular loss12 that accompanies the
increase in ß-amyloid and neuronal fibrillary tangles can be
identified on CT and MRI brain scans as brain
atrophy.13 It remains difficult to separate brain
atrophy and Alzheimer's disease from normal aging in the early
stages of Alzheimer's disease.14
Patients with Alzheimer's disease have been reported to have
greater ventricular volume and greater increase in
ventricular volume over time compared with that in control
subjects.15 Major changes in Alzheimer's
disease are often found in the hippocampus, amygdala, and temporal
lobe.16 There is no specific
diagnostic pattern on an MRI to separate
Alzheimer's disease from
"aging."13
Abnormal white matter findings on MRI are common among older
individuals and have been associated with older age and hypertension.
White matter lesions are likely related to vascular disease in the
long, penetrating arteries in the brain. White matter abnormalities
have been associated with a cognitive loss in some but not all
studies.17 18
The association of ApoE-4 genotype with Alzheimer's
disease has been repeatedly documented in both case-control and
longitudinal studies.19 20 Individuals who have
ApoE-4 genotype have a higher prevalence and earlier age of
onset of Alzheimer's disease.21 The
association of ApoE-4 with other causes of dementia, especially
vascular dementia, is less certain.22
 |
Methods
|
|---|
The design of the CHS has been
published.23 The original sample of the CHS
included 5201 adults 65 years of age or older recruited from a defined
sample of the Medicare files in four communities in the United States:
Forsyth County, NC; Sacramento County, Calif; Washington County, Md;
and Pittsburgh, Pa. The eligible participants were not
institutionalized and were expected to remain in the area for at least
the next 3 years. They were able to give informed consent that did not
require a proxy respondent at baseline. Participants were recruited to
the study between June 1989 and May 1990 (year 2). The original sample
of 5201 participants was 57% women and 95% Caucasian. In 1992 to 93
(year 5), 687 additional African-American participants were recruited
to the study in three of the four communities (Forsyth County, NC;
Sacramento, Calif; and Pittsburgh, Pa) (year 5) by similar methods as
in the original recruitment from the Medicare files. These participants
are referred to as the new CHS cohort.
Cognitive Testing
The baseline evaluation included home interviews and physical
examinations. At the baseline examination for the original cohort (year
2), participants completed the MMSE. The participants were then seen
yearly in the clinic. Beginning in year 3 of the study, the 3MSE
replaced the MMSE (see "Appendix") and was administered annually at
all clinic visits and on home visits when appropriate.
The 3MSE samples a wider range of cognitive abilities, extends the
ceiling and floor of the test, and enhances the reliability and
validity of the scores.1 2 The components of the
MMSE include short-term and delayed recall and temporal and spatial
orientation. The scores on the MMSE range from 0 to 30, and on the 3MSE
range from 0 to 100. Teng and coworkers reported that the mean score
was 43 for demented patients on the 3MSE, with a standard deviation of
26, and for normal control subjects 94, with a standard deviation of 6.
The scores on the MMSE and the 3MSE previously have been reported to be
highly correlated with age and education.1 2
In this report, we have used a cut-point of 80 for the 3MSE on the
basis of recommendations of the author of the 3MSE (E.L. Teng, PhD,
personal communication, 1995). The 3MSE just before or immediately
after MRI (within 60 days) was used in the year 5 and 6
analysis. A decrease of five or more points in the 3MSE between
the MRI and year 7 was considered a "significant change" in the
test score. All of the cut-points and changes in scores were defined
before the analysis of the results. The Spearman correlation
between 3MSE at years 3 and 5 to 6 for white participants in the CHS
without clinical stroke was .67 (data not shown). The digit symbol
substitution test (DSST) and the Benton Visual Retention Test ("C"
form) (years 6, 7, and 8 only) were also administered to the
participants.
The DSST is a measure of attention and speed. The Spearman correlation
between the digit symbol substitution test at year 5 and the 3MSE at
year 5 was .55. A low digit symbol score was classified as
<30.24
The Benton Visual Retention Test form C consists of 10 designs: The
participant sees the design for 10 seconds and then is asked to copy
it. We classified the Benton as 0, 1, or 2 correct versus 3 to 10
positive.25
MRI Examination
At years 5 and 6 of the study (1992 to 1994), all subjects were
invited to have a MRI of the brain to assess the extent and severity of
cerebral vascular disease. A detailed description of the MRI techniques
and methods of analyses have been
published.3
The scanning protocol included unenhanced sagittal and axial spin-echo
T1-weighted images (repetition time [TR], 500 msec; echo time [TE],
20 msec) and axial spin-density and T2-weighted images (TR, 3000 msec;
TE, 30 and 100 msec) in sections of 5-mm thickness, with no interslice
gaps, as detailed in the previously reported pilot study. Axial scans
were parallel to a line between the anterior and posterior commissures
(AC-PC line). All scans were performed without administration of
contrast.
Ventricle scores extended from slitlike ventricles (grade 0) to
markedly enlarged ventricles (grade 9). Sulci grades ranged in a
similar fashion. White matter changes were estimated by the total
extent of periventricular and subcortical white matter
signal abnormality on spin density weighted axial images graded by
successive increase from no changes or barely detectable changes
(grades 0 and 1, respectively) to almost all white matter involved
(grade 9). ILL were defined as focal, nonmass lesions in a vascular
distribution, hyperintense to grey matter on both spin density and
T2-weighted images.
The MRI examinations were completed for 3660 (62%) of 5888
participants in the CHS, including 3073 (62%) of 4927 white subjects,
566 (62%) of 916 black subjects, and 21 of other races. There were
2132 women and 1528 men who had MRI examinations. Having an MRI
examination was inversely related to age: 1350 age 65 to 69 years
(67%), 1237 age 70 to 74 (59%), 706 age 75 to 79 (50%), 284 age 80
to 84 (37%), and 83 age 85 or older (36%) underwent MRI examinations.
There were no differences in distinction of ApoE between the total
cohort and participants who had an MRI. Participants who completed MRIs
had higher scores on the 3MSE and the MMSE at year
2.26 They were better educated (25.5% college or
higher) compared with 18% for those who did not have an MRI. Of those
who had an MRI, 28% had a history of clinical
cardiovascular disease compared with 37% with a
history of clinical cardiovascular disease for
participants who did not have an MRI at years 5 to 6. The
analysis of the MRI cohort underestimates the prevalence of low
3MSE in the population.
The reasons for not having an MRI included the following: the patient
died before the MRI examination (374); no clinic visit in years 5 to 6
(477); patient refused (566); MRI contraindications (277); patient
unable to complete MRI (439); and other.27
We classified the MRI parameters both as a continuous
variables and as categorical variables (ie, high and low
categories). For categorical analysis in this report, we coded
variables as follows: for infarcts (>3 mm) 0 versus 1 to
5 ILL; for white matter grades 0 to 2 versus grades 3 to 9; for sulci
width 1 to 4 versus 5 to 8; and for ventricle size 1 to 4 versus 5 to
9. Several studies describing the results of the initial MRI
examination in the CHS have recently been
published.26 27 28 29
Measurement of ApoE
The three major allelic forms of the ApoE gene were determined
in the Core Molecular Genetics facility at the University of Vermont
College of Medicine by the method of Hixson and
Vernier.30 The two primers used for polymerase
chain reaction amplification, done in 96-well microtiter plates, were
5'GGCACGGCTGTCCAAGGA3' and 5'ACAGAATTCGCCCCGGCCTGGTACAC3'. Amplitaq T4
DNA polymerase was obtained from Perkin-Elmer; the restriction enzyme
HhaI was obtained from New England BioLabs. DNA samples
known to be E4/E4 and E2/E3 were analyzed with each batch as
positive controls. The restriction patterns were determined with the
use of agarose electrophoresis.31 Of the 5888
participants in CHS, ApoE was assessed for 4607 (93%) of white
subjects, 850 (93%) of black subjects, and 37 (82%) of others.
Subclinical and Clinical Vascular Disease and Stroke
At baseline (year 2) for the original cohort and at year 5 for
the new cohort, prevalence and extent of clinical
cardiovascular disease was assessed. Clinical vascular
disease was defined as a confirmed history of heart disease, including
MI, angina pectoris, CHF, coronary bypass surgery, atrial
fibrillation as detected by electrocardiogram, use of a
cardiac pacemaker, history of stroke or transient ischemic
attack or carotid artery surgery, and history of intermittent
claudication or peripheral vascular surgery. Note that
clinical CVD includes both cardiovascular,
cerebrovascular, and lower extremity peripheral vascular
disease.
Subclinical CVD was defined as ankle-arm index
0.9 mm Hg,
internal carotid wall thickness >80th percentile, common carotid wall
thickness >80th percentile, carotid stenosis >25%, major
electrocardiogram abnormalities, or Rose Questionnaire
positive for claudication or angina.32
Statistical Methods
Tests for linear trend involved the use of Cochran-Mantel
2 tests. Logistic regression models were used
to model low cognitive function scores or large changes in cognitive
function scores between two examinations. The logistic analyses
included age, sex, race, education level, subclinical and clinical
disease status, and presence of ApoE-4 as variables in the models.
For models looking at change in cognitive scores between two time
points, the cognitive test score at the first time point was included
as a covariate in the logistic model. Stepwise logistic regression with
the above variables forced into the model allowed for assessment of
the significance of interactions.
Statistical tests were significant P<.05 and Wald 95%
confidence intervals computed from the logistic regression
analyses.33 All analyses were
performed with the use of SAS. The analysis has been limited in
this study to demographic variables, age, sex, race, education,
measure of subclinical and clinical cardiovascular
disease, MRI variables, and measurement of ApoE. The primary
purpose of this report was to test the hypothesis that MRI
variables, ApoE-4, and measure of subclinical and clinical
cardiovascular disease are predictors of cognitive
function scores.
 |
Results
|
|---|
Characteristics of the CHS participants, those who had an MRI,
ApoE, and 3MSE cognitive testing at year 5 to 6 and are included in the
analysis are shown in Table 1
.
The mean age at entry to the CHS was 71 years. There were 3469 white
and black participants, including 206 with a history of stroke before
the MRI examination.
ApoE Measurements
The distribution of ApoE genotype for the entire CHS
cohort was measured. There were 5457 participants who had ApoE
measurements, and 3480 (64%) of these participants (Table 1
) also had
an MRI examination. The frequency of the ApoE-44 genotype was
1.6%, and 25.6% of the 5457 participants had at least one ApoE-4
gene. The distribution of ApoE was similar when restricted to
participants who had an MRI examination.
The percentage of participants with at least one ApoE-4 allele was
significantly higher among black subjects (31.6%) than white subjects
(24.4%). This race difference persisted after adjustment for age. The
percentage of participants with ApoE-4 decreased with age: 27.3% of
participants 65 to 69 years old compared with 21.2% older than 80 had
at least one ApoE-4 allele. The distribution of ApoE
genotypes was not significantly different for men and women,
and there was no consistent relationship between levels of
education and ApoE-4 genotypes (not shown). The observed
distribution of ApoE genotypes was similar to that seen in
other studies of older individuals.34 35
Relationship of ApoE-4 to Subclinical and Clinical Disease and
MRI Measurements
At CHS baseline, 31% of white participants and 36% of black
participants had clinical CVD by CHS criteria, 42% of white
participants and 41% of black participants had subclinical CVD, and
28% of white participants and 23% of black participants had neither
subclinical nor clinical CVD. In bivariate analysis, there was
no consistent relationship between any measure of subclinical
or clinical CVD at baseline and ApoE-4 (not shown).
There was also no relationship between ApoE-4 and either the presence
or absence of infarcts
3 mm on the MRI or the number of infarcts
or other measures on MRI, sulci width, ventricle size, and white matter
changes (not shown).
Modified Mini-Mental State Examination
The 3MSE scores were substantially lower in black subjects than in
white subjects (Table 1
). The percent of participants with 3MSE <80
increased with age and lower education. In bivariate analysis
the percentage with low 3MSE varied from 9.3% for black subjects and
2.5% for white subjects 65 to 69 years old to 51.7% for black
subjects and 22% for white subjects 80 or older. Approximately 42% of
black subjects and 13% of white subjects with less than a high school
education had low 3MSE scores. However, for those with college
education or more, the percentage with a low score was similar for
black subjects (3.3%) and white subjects (2.2%). The prevalence of
scores <80 was greater for participants with a history of stroke
before the MRI (Table 1
).
Relationship of MRI ApoE to Low Modified Mini-Mental State Score at
Time of MRI
In the bivariate analysis for participants without a prior
history of stroke, a low score (<80) on the 3MSE measurement at the
time of the MRI was significantly related to several MRI variables,
white matter grade, infarctlike lesions, ventricular
volume, and sulci width (Table 2
). The
association of MRI findings with 3MSE low scores was not significantly
different for men compared with women or for black subjects compared
with white subjects. For stroke cases, the prevalence of the MRI
changes was higher and the mean 3MSE was lower. For white subjects, the
number of previous 3MSE tests before MRI could have been 3 to 4 times,
whereas for the new cohort of black subjects, the year 5 test was their
first 3MSE evaluation. Learning effects for the 3MSE therefore could
affect differences in scores between black subjects and white subjects.
However, the scores were similar for black subjects in the original
cohort recruited in year 2, the same time as for white subjects and the
year 5 new cohort of black subjects.
View this table:
[in this window]
[in a new window]
|
Table 2. Relationship Between MRI Variables and Modified
Mini-Mental State Examination at Years 5 to 6 by Race, No Prior History
of Stroke
|
|
The association of low 3MSE scores with age, education, sex,
subclinical disease at baseline, ApoE-4, and MRI findings was evaluated
with the use of logistic regression; the 3MSE score was the dependent
variable (< 80). The analysis excluded participants with a
history of stroke before the MRI and is presented in Table 3
.
Overall, high ventricle volume scores, high white matter grade
scores, presence of MRI ILL
3 mm, and presence of ApoE-4 were
related to low 3MSE (<80) scores at year 5 to 6 in the multiple
logistic regression analysis that included adjustment for
confounding by age, education, and sex. These associations were very
similar for black subjects and white subjects.
The association of MRI variables and low 3MSE scores (<80) was
different for men and women. For women, large ventricles (OR, 2.7; 1.7
to 4.4) was the stronger risk factor on MRI. For men, sulci width (OR,
1.7; 1.1 to 2.8), was most highly related to a low 3MSE score. The
association of low 3MSE with MRI ILL and white matter score were
similar in men and women.
The determinants of low score on the digit symbol substitution test
were similar to the results for the 3MSE (not shown) for both black
subjects and white subjects.
MRI and Changes in the Modified Mini-Mental State Scores, Years 5
to 7
There were 3253 white subjects and 584 black subjects alive
at year 7 (excluding those with a prior stroke history) who had repeat
3MSEs. Of the 3253 white subjects, 655 (20.6%) had a decrease of at
least 5 points on the 3MSE between years 5 to 7 compared with 133
(22.7%) of 584 black subjects. The percentage with declining scores
was not significantly different (OR, 0.97; 0.74 to 1.26) (Table 4
) for black subjects and white subjects
(Table 5
) and for men and women (not
shown). The probability of a decline of five or more points was related
to age (15%, 65 to 69 years at entry versus 42%, 80 or older;
P=.001) and to education (30% in those with less than high
school education to 17% in those with a college diploma) (not shown)
(P=.001).
View this table:
[in this window]
[in a new window]
|
Table 4. Multivariate Analysis of
Determinants of Decline of Five or More Points, Years 5 to 6 and Year 7
(Excluding Stroke Cases)1
|
|
View this table:
[in this window]
[in a new window]
|
Table 5. Five-Point Decrease or Greater in Modified
Mini-Mental Scores Over a 3-Year Period After MRI by Age Group
|
|
The decline in scores between years 5 to 7 was related to scores at
year 5 as 43.6% (24 of 55) participants with year 5 scores <70 versus
18.8% with year 5 scores of
90 had declined five points between
years 5 to 7 (P=.0001) (Table 5
).
The decline of 5 points from years 5 to 7 was also related to the
presence of ApoE-4 gene (Figure
). Several of the
variables measured by the MRI at year 5 were also related to a
5-point decline, including number of infarcts
3 mm, high sulci
width, white matter grade, and size of ventricles (P=.001)
for all MRI variables (Figure
). In the multivariate
model (Table 4
) high white matter grade, MRI infarcts, high
ventricular volume, ApoE-4, and subclinical
cardiovascular disease at baseline were predictors of
decline of five or more points.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 1. Determinants of decrease in Modified Mini-Mental State
of five or more points between years 5 and 6 to 7 (MRI measures, years
5 to 6) (comparison of black and white participants).
|
|
Among white participants with no clinical
cardiovascular disease before MRI (including stroke),
the decline in the MMSE between years 5 to 7 was directly related to an
incident stroke after MRI (n=29; OR, 3.6; 1.2 to 10.2) but weakly
related to incident MI (n=47; OR, 1.5; 0.6 to 4.2), or angina pectoris
(n=116; OR, 1.4; 0.8 to 2.5). These results were based on the logistic
regression analysis that included age, education, sex, MRI
measures, and prevalent subclinical/clinical disease (Table 6
). The association of stroke with
decline of five points in score between years 5 and 7 was especially
strong for white women (OR, 6.0; 1.5 to 24.0) compared with men (OR,
1.6; 0.4 to 9.2; not shown). Further inclusion of low 3MSE at year 5 to
6 (OR, 1.4; 0.9 to 2.2) or duration of follow-up between examinations
(0.7, 0.5 to 1.0) did not affect the results. There were too few events
among black subjects between years 5 and 6 (seven strokes and seven
MIs) to analyze this subgroup.
Modified Mini-Mental State Examination at Year 7 Prospective
Analysis
In multivariate analysis the primary
predictors of a low 3MSE at year 7 were similar to years 5 to 6 (Table 4
) education indicators, low 3MSE at years 5 to 6, ApoE-4 (OR, 1.6; 1.2
to 2.2), high ventricle volume (OR, 1.5; 1.1 to 2.2), high white matter
grade (OR, 1.4; 1.0 to 1.9), and ILL on MRI (OR, 1.4; 1.1 to 2.0) but
not subclinical (OR, 1.1; 0.8 to 1.6) or clinical disease (OR, 0.7; 0.5
to 1.1) at baseline. The results were similar if low score on the 3MSE
at years 5 to 6 was not included in the analysis. The results
were also similar for black subjects and white subjects except that
ApoE-4 (OR, 1.1; 0.6 to 2.2) was not significantly related to low score
among black subjects.
 |
Discussion
|
|---|
The CHS is one of the largest longitudinal studies of older
individuals that includes measures of cognition, ApoE, MRI of the
brain, and clinical and subclinical vascular disease.
The DSM IV36 diagnostic criteria for
dementia includes the development of multiple cognitive deficits, one
of which must be memory impairment, which causes impairment in social
and occupational functioning and a decline in functioning over time.
Low scores on screening tests such as the MMSE are not synonymous with
dementia but are powerful risk factors for
dementia.37 38
There are four variables that are related to both low 3MSE scores
(<80) at year 5 and decline in scores between years 5 to 7, including
(1) demographic factors (low education levels and increasing age), (2)
measures of possible brain atrophy on MRI (higher
ventricular volume), (3) measures of vascular disease
(prevalent and incident stroke, MRI infarcts >3 mm and higher
white matter grade), and (4) genetic factors/host susceptibility
(prevalence of ApoE-4).
Education and Age
Education and age were very powerful determinants of a low 3MSE
score at years 5 to 6 and 7. Cognitive scores declined with increasing
age. Lower prior education levels are associated with poorer cognitive
scores and probably, a higher incidence and prevalence of dementia of
the Alzheimer's type.39 40 41 42 43 44 45 46 The CHS was
unique in having included a large sample of older individuals with both
less than a high school education and more than a college degree. Black
participants had a much higher prevalence of low 3MSE scores <80
(21.6%) compared with 5.7% for white participants. For both black and
white participants there was a very strong association of age and
education to low scores. The very large OR for low 3MSE scores for
black participants with less than a high school education compared with
college-educated black participants (45-fold) (Table 3
) demonstrates
the importance of education on cognitive function tests. For each age
and education group, low 3MSE scores were more prevalent among black
participants compared with white participants. However, the prevalence
of scores <80 on the 3MSE among college-educated black participants
was similar to the prevalence of low 3MSE for college-educated white
participants (3.8% and 2.5%, respectively) and much lower than for
black or white participants with no high school diploma.
The educational attainment of this older cohort (mean age of 73 years
at entry) is related to education and socioeconomic factors 50 to 60
years ago (1930 to 1940s). In the CHS sample, 23% of white subjects
had less than a high school education, 54% high school and/or some
college, and 23% college education or greater compared with 39% of
black subjects with less than a high school education, 43% high school
and/or some college, and 18% with a college education. The difference
in prevalence of low scores (<80 on 3MSE) among black subjects with
less than a high school compared with a high school education (41.5%
versus 3.3%) may be due to effects of education, to effects of
environmental agents on the brain and cognitive function early in life,
to subsequent differences in lifestyle after completing their
education, or to effects of hypertension, diabetes, and vascular
disease, which have higher prevalence in less-educated black subjects
and white subjects, and may be risk factors for low cognitive scores
and MRI abnormalities. The prevalence of MRI abnormality in this study,
however, were similar for black subjects and white subjects. The
differences in level of "formal education" do not measure the
quality of formal education years ago nor the effect of informal
educational experiences that could have effected the test results.
ILL, ventricular volume, high white matter grade on MRI,
and ApoE-4 were all related to low scores on the Benton Visual
Retention Test (form C),36
DSST,24 and 3MSE for both black and white
subjects, and there was relatively little difference in the strength of
the associations among the three tests for black subjects compared with
white subjects. The results were also similar for the original black
cohort recruited in 1989 to 1990 and the new black cohort (1992 to
1993) that had not been previously tested.
The five-point decline in 3MSE scores between years 5 and 7 was related
to both age and education and were similar for black subjects and white
subjects. The follow-up (maximum approximately 3 years) is short, and
further long-term follow-up may identify other determinants of change
in 3MSE scores.
The CHS does not include a measure of clinical dementia. The 3MSE is
biased as a screening instrument for possible dementia, as are many
other neuropsychological screening instruments. Many investigators have
noted differences by education and race in the sensitivity and
specificity of screening instruments compared with clinical diagnosis
of dementia.47 48 Prior education and experience
with some of the items on the neuropsychological tests may influence
the test scores. The results of the Benton were also similar to the
3MSE and DSST.
None of these tests, however, have been extensively used for evaluating
population samples of black subjects. There is no population data
demonstrating the relationship of test scores to clinical dementia
within the black populations.
Ventricular Atrophy
Measures of brain morphology based on the MRI examination, as
indicated by ventricle size and white matter lesions, and MRI infarct
were related to low scores on the 3MSE and to a decline in scores over
time. Most of these associations were similar for black subjects and
white subjects. The confidence limits overlapped unity for black
subjects in some analyses. This could be due to the smaller
sample size in this racial group.
One of the most important observations of the study was the strong and
independent association of large ventricles (as measured by the MRI)
with low scores on the 3MSE and decline in scores of at least five
points between years 5 to 7. The MRI measures of
ventricular atrophy may identify a group of participants at
very high risk of cognitive loss. If participants with lower scores and
decreasing scores over time are likely to have clinical dementia, then
measures of ventricle volume on MRI may select individuals likely to
decline and be at very high risk of dementia.
Vascular Disease in the Brain
Both white matter grade and number of ILL on MRI were related to
low score (<80) at years 5 to 7 and declines in 3MSE scores between
years 5 to 7. The ILL and white matter abnormalities are likely related
to vascular disease.18 29 Various measures of
subclinical disease such as carotid artery wall thickness,
stenosis, or decreased ankle-brachial blood pressure are risk
factors for MRI infarcts26 and white matter
abnormality.29 Both "MRI ILL" and infarct
found at postmortem examination have been associated with
dementia.17 A recent study has suggested that
cerebral infarct and pathology associated with Alzheimer's
disease (ie, increased plaques and tangles) are related to a greater
likelihood of antemortem clinical diagnosis of Alzheimer's
disease.49
We assessed the relationship between the number of ILL and cognition in
this analysis. It is also likely that the location and size of
infarcts (ie, cerebral cortex) may be related to both cognitive scores
and rate of decline over time. In the CHS, 64% of infarcts
3 mm
among participants without a history of prevalent stroke were in the
basal ganglia. The CHS is evaluating the association of location of ILL
and scores on 3MSE, DSST, and measure of disability.
Incident stroke after the MRI in years 5 to 6 was associated with a
substantial decline in 3MSE scores between years 5 and 7. The number of
incident events was low, and poststroke follow-up only approximately 1
to 2 years.
In the Rochester, Minnesota study, the risk of dementia after a stroke
was increased 9-fold in the first year compared with the nonstroke
age-matched population, again consistent with effect of stroke
on decline in 3MSE scores within 1 or 2 years after stroke. The risk of
dementia was increased about 2-fold in the Mayo Study more than 1 year
after stroke.8
The pathophysiology of dementia after stroke or associated with MRI ILL
and white matter grade still needs further
study.50 The association of stroke to decreased
cognitive function and dementia is likely grossly underestimated
because of the high case-fatality rate among older individuals with
incident stroke as well as the likelihood that disabled stroke patients
are not included in large clinic follow-ups, such as in dementia
clinics. It is also likely that some patients have unrecognized
dementia before their stroke. Stroke cases that became demented also
have a shorter life expectancy.
Approximately 5% of the population over age 65 years have prevalent
stroke. Approximately 25% of stroke patients become demented after
their stroke. One study has estimated that there are 430 000 stroke
cases that are demented over the age of 65 in the United States and
that 62% (266 000) have their dementia directly related to stroke.
Prevention of stroke could possibly substantially reduce the prevalence
and incidence of dementia in the
population.51
Low scores on cognitive tests have also been reported to be a risk
factor for clinical stroke.52 It is possible that
risk factors such as hypertension, diabetes, and
hyperlipidemia may lead to brain changes such as ILL
and high white matter grade that are associated with lower scores on
cognitive function tests and therefore also on increased risk of
clinical stroke. Treatment of risk factors could possibly reduce both
risk of clinical stroke and cognitive decline.
Subclinical cardiovascular disease at baseline
was related to a 3MSE score <80 at year 5, white subjects only, and
decline in scores between years 5 and 7, black subjects and white
subjects, after adjustment for confounding by age, education, and MRI
measures (Tables 3
and 4
). These results are consistent with a
recent report from the Rotterdam Study,22 which
found that carotid artery wall thickness, ankle-brachial blood
pressure, and ApoE-4 were strong predictors of both vascular and
Alzheimer's diseaserelated dementia. However, these
associations were cross-sectional. In the CHS (for the white cohort),
the measures of subclinical disease were done at baseline,
approximately 3 years before the 3MSE evaluation. The measures of
subclinical disease for most of the black cohort were done concurrently
with the 3MSE and MRI at year 5 or 6.
In the Rotterdam Study (age 55 to 94 years), histories of both MI and
stroke were associated with a low score on the MMSE at baseline
examination.53 In the CHS, the OR for MI was
increased 1.5, but confidence limits were wide (0.6 to 4.2) because of
the small number of incident MI cases.
ApoE
ApoE-4 was associated with both low 3MSE scores (<80), in black
subjects and white subjects at years 5 and 7 (approximately a twofold
difference stronger in white subjects than black) and a decline of five
or more points between years 5 to 7 in white subjects only. Several
studies have also shown that ApoE-4 is related to a more rapid decline
in cognitive scores over time54 and early changes
in brain metabolism.55 56 The
combination of lower initial scores on cognitive tests and ApoE-4 may
be an important determinant of risk of dementia.
The association of ApoE polymorphism and vascular dementia is more
controversial than for Alzheimer's disease. ApoE-4 is
associated with higher levels of LDL cholesterol, premature
atherosclerosis, and higher incidence of clinical
coronary heart disease.57 58 There is
relatively little evidence for a relationship between ApoE-4
genotype, extent of cardiovascular disease, and
risk of dementia.59 The prevalence of subclinical
or clinical cardiovascular disease and MRI changes were
not significantly different for participants who had or did not have
ApoE-4 genotype in the CHS. The association of ApoE-4 with
lower cognitive scores was not due to higher prevalence of
atherosclerotic vascular disease associated with ApoE-4. Individuals
with ApoE-4 genotype at postmortem examination have a higher
prevalence of neuropathological changes of Alzheimer's
disease, extracellular deposition of ß-amyloid, and the intracellular
neurofibrillary tangles.19 A population-based
study in New York City and Rotterdam, The Netherlands, reported that
the prevalence of ApoE-4 was significantly higher (OR, 1.8; 1.2 to 2.7)
for heterozygote ApoE-4 stroke cases with dementia compared with
control subjects.60
In the Zutphen Study of older men, ApoE-4 was associated with a 2-fold
increased risk of impaired cognitive function.61
There was a very strong association of cerebrovascular disease, ApoE-4,
and decline in scores. The prevalence of both an ApoE-4 and stroke was
associated with a 17-fold greater risk of cognitive decline compared
with those with no history of stroke and not ApoE-4. The results are
similar to the current CHS study.
Diagnosis of Dementia
The CHS does not include a clinical diagnosis of dementia and
included only screening tests for possible dementia (3MSE, DSST, and
the Benton Visual Retention Test). The sensitivity and specificity of a
cut-point of 80 on the 3MSE test is very high for diagnosis of
dementia. The Canadian Study of Aging and Health used the 3MSE to
establish the prevalence of dementia in five regions of
Canada.62 63 A cut-point of 77 to 78 was used to
select individuals for further evaluation. Of the 8949 screened, 1614
(18%) scored below 78. The subjects who scored below 78 and all
institutionalized participants had a further detailed neurological and
psychiatric evaluation. (2420) Approximately 50% (1125) were
subsequently diagnosed as being demented, 772 as having cognitive loss
without dementia, and 523 as normal, including 358 (36%) of 1006
community control subjects who initially scored below 77 to 78. There
were 494 individuals who had a "normal 3MSE" >78, and only 7
(1.4%) were found to be demented by further detailed neurological and
psychiatric evaluation.
The 3MSE is very similar to the Cognitive Abilities Screening
Instrument (CASI) used in the Honolulu-Asia aging
study.64 A score of 82 on the CASI is equivalent
to approximately 25 to 26 on the MMSE. In the Honolulu-Asia study, 92%
of the dementia cases diagnosed by DSM IIIR criteria scored <82 on the
CASI.65
Isolated memory loss was recently documented in the Seattle Dementia
Study to be a strong predictor of subsequent clinical dementia; 10 of
21 individuals (48%) with isolated memory loss became clinically
demented during a 48-month follow-up period.66
Verbal memory loss is also an early sign of
dementia.66 67 68
The positive prediction of being demented, given a low score on a
cognitive screening test such as the 3MSE, is still not very high,
given the relatively low prevalence or incidence of dementia in the
population.69 If the prevalence of dementia was
10% among 1000 participants and the sensitivity and specificity of low
scores for identifying dementia were both 90%, then only 50% of
individuals with low score (<80) would be classified as demented and
10 (1.2%) of the 820 who scored >80 would be demented. Over time,
however, many of the individuals who scored <80 will be classified as
demented. Therefore, it is likely that some CHS participants with
scores <80 on the 3MSE were not clinically demented at the time of the
cognitive testing or MRI. The association of MRI changes and/or 3MSE
scores <80 or decline in scores over time could be stronger for
participants with low scores (<80) and clinical dementia or
"vascular dementia" or be related to low scores (<80) but not to
clinical dementia.
A decline in score over time is an important criterion for
dementia.36 For white subjects in the CHS, it was
possible to determine the relationship between cognitive scores at
baseline year 2 by using the MMSE and the 3MSE at years 5 to 6 to
determine whether the white participants who had a low score at years 5
to 6 had entered the study with lower scores. Among the 2946 white
participants with MRI and ApoE measurements, 95 (3.2%) scored <24 on
the MMSE at entry to the CHS and 45 of these 95 (42%) scored <80 at
year 5 to 6. These 45 participants who scored <80 at year 2 accounted
for 24% of the scores <80 at years 5 to 6. In addition, 34 of the 45
participants who scored <70 at year 5 (approximately 75%) had a
decrease of at least five points on the 3MSE between years 3 and 5 of
the CHS.
These results suggest that the lower scores at years 5 and 7 (at least
for the white cohort in CHS) were a function of both lower scores at
entry (year 2) and decline between years 2 to 5 and 7. The majority of
the black cohort entered the study in year 5 and have had a relatively
short follow-up.
There are several other reasons for low cognitive scores other than
"possible dementia." There was a relatively weak association
between depression as measured by the 10-item version of the Center for
Epidemiology Studies'
(CES-D)70 depression scale and low cognitive
scores.
Reported alcohol consumption was very low in the CHS and was not a
major factor in the 3MSE scores. Prevalent stroke was excluded from
much of the analysis because of the strong association between
stroke and low 3MSE scores. A history of Parkinson's disease (29 men
and 30 women in the original cohort of 5201 at year 2 and only 1 in the
new cohort at year 5) was low in the CHS. The major drugs used in the
CHS were primarily for the treatment of hypertension. There was only a
weak relationship between antihypertensive therapy and 3MSE. Only
approximately 10% of the cohort was using antidepressant drugs; of 394
participants in the original cohort who scored <80 at year 5 to 6, 33
(8.4%) were taking benzodiazepines.
We also asked participants whether they had vision or hearing problems.
In the original cohort of 5201 participants, 100 (25%) of 394 had a
vision problem and 76 (19.3%) had hearing problems among those that
scored <80 on the 3MSE at year 5 compared with 15% with vision and
10% with hearing problems who scored >80. The prevalence of vision
problems and especially hearing problems increase with age and may
contribute to some of the lower 3MSE score results. Efforts were made
by the staff at yearly examinations to evaluate hearing and vision
problems. It is unlikely that any of these variables had a major
effect on low 3MSE scores.
Conclusions
This study documents that the prevalence of low scores on
neuropsychological test of cognition and decline in scores over time
are related to MRI vascular findings, ILL, white matter grade, and to
the size of the ventricles. ApoE-4 has an independent association with
prevalence of low scores and decline in scores. The MRI findings and
ApoE-4 are generally independent of the powerful effects of age and
education on cognitive test scores.
In the immediate future, it will be very important to determine whether
the measures on MRI and subclinical vascular disease, genetic
polymorphisms (such as ApoE) will be strong predictors of clinical
dementia and types of dementia.
 |
Selected Abbreviations and Acronyms
|
|---|
| Apo |
= |
apolipoprotein |
| CHF |
= |
congestive heart failure |
| CHS |
= |
Cardiovascular Health Study |
| CI |
= |
confidence interval |
| clinical/subclinical CVD |
= |
clinical/subclinical cardiovascular disease |
| ILL |
= |
infarctlike lesions |
| MI |
= |
myocardial infarction |
| MMSE |
= |
Mini-Mental State Examination |
| MRI |
= |
magnetic resonance imaging |
| OR |
= |
odds ratio |
| 3MSE |
= |
Modified Mini-Mental State Examination |
|
 |
Appendix 1
|
|---|
Participating Institutions and Principal Staff.
Forsyth County, NCBowman Gray School of Medicine of Wake Forest
University: Gregory L. Burke, Sharon Jackson, Alan Elster,
Walter H. Ettinger, Curt D. Furberg, Gerardo Heiss, Dalane Kitzrnan,
Margie Lamb, David S. Lefkowitz, Mary F. Lyles, Cathy Nunn, Ward Riley,
John Chen, Beverly Tucker; Forsyth County, NCBowman Gray
School of Medicine-EKG Reading Center: Farida Rautaharju,
Pentti Rautaharju; Sacramento County, CalifUniversity of California,
Davis: William Bomrner, Charles Bernick, Andrew Duxbury, Mary Haan,
Calvin Hirsch, Lawrence Laslett, Marshall Lee, John Robbins, Richard
White; Washington County, Md-The Johns Hopkins University:
M. Jan Busby-Whitehead, Joyce Chabot, George W. Comstock, Adrian Dobs,
Linda P. Fried, Joel G. Hill, Steven J. Kittner, Shiriki Kurnanyika,
David Levine, Joao A. Lima, Neil R Powe, Thomas R Price, Jeff
Williamson, Moyses Szklo, Melvyn Tockman; MRI Reading
Center-Washington County, Md-The Johns Hopkins University: R. Nick
Bryan, Norman Beauchamp, Carolyn C. Meltzer, Naiyer Iman, Douglas
Fellows, Melanie Hawkins, Patrice Holtz, Michael Kraut, Grace Lee,
Larry Schertz, Cynthia Quinn, Earl P. Steinberg, Scott Wells, Linda
Wilkins, Nancy C. Yue; Allegheny County, PaUniversity of
Pittsburgh: Diane G. Ives, Charles A. Jungreis, Laurie
Knepper, Lewis H. Kuller, Elaine Meilahn, Peg Meyer, Roberta Moyer,
Anne Newman, Richard Schulz, Vivienne E. Smith, Sidney K. Wolfson;
Echocardiography Reading Center
(Baseline)University of California, Irvine: Hoda
Anton-Culver, Julius M. Gardin, Margaret Knoll, Tom Kurosaki, Nathan
Wong; Echocardiography Reading Center
(Follow-Up)Georgetown Medical Center: John Gottdiener, Eva
Hausner, Stephen Kraus, Judy Gay, Sue Livengood, Mary Ann Yohe, Retha
Webb; Ultrasound Reading CenterGeisinger Medical Center:
Daniel H. O'Leary, Joseph F. Polak, Laurie Funk; Central Blood
Analysis LaboratoryUniversity of Vermont: Edwin
Bovill, Elaine Cornell, Mary Cushman, Russell P. Tracy; Respiratory
SciencesUniversity of Arizona-Tucson: Paul Enright; Coordinating
CenterUniversity of Washington, Seattle: Alice Arnold, Annette L.
Fitzpatrick, Bonnie K Lind, Richard A. Kronmal, Bruce M. Psaty, David
S. Siscovick, Lynn Shemanski, Will Longstreth, Patricia W. Wahl, David
Yanez, Paula Diehr, Maryann McBurnie, Chuck Spieker, Scott Emerson,
Cathy Tangen, Priscilla Velentgas; NHLBI Project Office: Diane E.
Bild, Robin Boineau, Teri A. Manolio, Peter J. Savage, Patricia
Smith.
 |
Acknowledgments
|
|---|
This study was supported by contracts N01-HC-85079 through
N01-HC-85086 and N01-HC-15103 from the National Heart, Lung, and
Blood Institute.
Received September 29, 1997;
revision received November 18, 1997;
accepted December 4, 1997.
 |
References
|
|---|
-
Teng EL, Chui HC. The Modified Mini-Mental State
(3MS) Examination. J Clin Psychiatry. 1987;48:314318.[Medline]
[Order article via Infotrieve]
-
Teng EL, Chui HC, Gong A. Comparisons between the
Mini-Mental State Exam (MMSE) and its modified versionthe 3MS test.
In: Hasegawa K, Homma A, eds. Psychogeriatrics Biomedical and
Social Advances. Amsterdam/Princeton/Hong
Kong/Tokyo/Sydney: Excerpta Medica; 1990:189192.
-
Bryan RN, Manolio TA, Schertz LD, Jungreis C, Poirier
VC, Elster AD, Kronmal RA. A method for using MR to evaluate the
effects of cardiovascular disease on the brain: the
Cardiovascular Health Study. Am J
Neuroradiol. 1994;15:16251633.[Abstract]
-
Roman GC, Tatemichi TK, Erkinjuntti T, Cummings JL,
Masdeu JC, Garcia JH, Amanducci L, Orgogozo JM, Brun A, Hofman A, Moody
DM, O'Brien MD, Yamaguchi T, Grafman J, Drayer BP, Bennett DA, Fisher
M, Ogata J, Kokmen E, Bermejo F, Wolf PA, Gorelick PB, Bick KL, Pajeau
AK, Bell MA, DeCarli C, Culebras A, Korczyn AD, Bogousslavsky J,
Hartmann A, Scheinberg P. Vascular dementia: diagnostic
criteria for research studies: report of the NINDS-AIREN International
Workshop. Neurology. 1993;43:250260.[Abstract/Free Full Text]
-
Ott A, Breteler MMB, van Harskamp F, Claus JJ, van der
Cammen TJM, Grobbee DE, Hofman A. Prevalence of Alzheimer's
disease and vascular dementia: association with education: the
Rotterdam Study. BMJ. 1995;310:970973.[Abstract/Free Full Text]
-
Hebert R, Brayne C.
Epidemiology of vascular dementia.
Neuroepidemiology. 1995;14:240257.[Medline]
[Order article via Infotrieve]
-
Emery VO, Gillie EX, Ramdev PT. Noninfarct vascular
dementia: a new subtype. J Clin Geropsychol. 1996;2:197213.
-
Kokmen E, Whisnant JP, O'Fallon WM, Chu CP, Beard CM.
Dementia after ischemic stroke: a population-based study in
Rochester, Minnesota (19601984). Neurology. 1996;19:154159.
-
Prencipe M, Ferretti C, Casini AR, Santini M, Giublei
F, Culasso F. Stroke, disability, and dementia: results of a population
survey. Stroke. 1997;28:531536.[Abstract/Free Full Text]
-
Pohjasvaara T, Erkinjuntti T, Vataja R, Kaste M.
Dementia three months after stroke: baseline frequency and effect of
different definitions of dementia in the Helsinki Stroke Aging Memory
Study (SAM) cohort. Stroke. 1997;28:785792.[Abstract/Free Full Text]
-
Tatemichi TK, Paik M, Bagiella E, Desmond DW, Pirro M,
Hanzawa LK. Dementia after stroke is a predictor of long-term survival.
Stroke. 1994;25:19151919.[Abstract]
-
Hamos JE, DeGennaro LJ, Drachman DA. Synaptic loss in
Alzheimer's disease and other dementias. Neurology. 1989;39:355361.[Abstract/Free Full Text]
-
Jagust WJ. Functional imaging patterns in
Alzheimer's disease: relationships to neurobiology. Ann
N Y Acad Sci. 1996;777:3036.[Abstract]
-
Coffey CE, Wilkinson WE, Parashos IA, Soady SAR,
Sullivan RJ, Patterson LJ, Figil GS, Webb MC, Spritzer CE, Djang WT.
Quantitative cerebral anatomy of the aging brain: a
cross-sectional study using magnetic resonance imaging.
Neurology. 1992;42:527536.[Abstract/Free Full Text]
-
Fox NC, Freeborough PA, Rossor MN. Visualisation and
quantification of rates of atrophy in Alzheimer's disease.
Lancet. 1996;348:9497.[Medline]
[Order article via Infotrieve]
-
Jobst KA, Smith AD, Szatmari M, Esiri MM, Jaskowski A,
Hindley N, McDonald B, Molyneux. Rapidly progressing atrophy of medial
temporal lobe in Alzheimer's disease. Lancet. 1994;343:829830.[Medline]
[Order article via Infotrieve]
-
Tatemichi TK, Sacktor N, Mayeux R. Dementia associated
with cerebrovascular disease, other degenerative diseases, and
metabolic disorders. In: Terry RD, Katzman R, Bick KL, eds.
Alzheimer's Disease. New York, NY: Raven Press,
Ltd; 1994:123166.
-
Breteler MMB, van Amerongen NM, van Swieten JC, Claus
JJ, Grobbee DE, van Gijn J, Hofman A, van Harskamp F. Cognitive
correlates of ventricular enlargement and cerebral white
matter lesions on magnetic resonance imaging: the Rotterdam Study.
Stroke. 1994;25:11091115.[Abstract]
-
Roses AD. Apolipoprotein E alleles as risk factors
in Alzheimer's disease. Annu Rev Med. 1996;47:387400.[Medline]
[Order article via Infotrieve]
-
Farrer LA, Cupples A, Haines JL, Hyman B, Kukull WA,
Mayeux R, Myers RH, Pericak-Vance MA, Risch N, van Duijn CM, for the
APOE and Alzheimer's Disease Meta Analysis Consortium.
Effects of age, sex, and ethnicity on the association between
apolipoprotein e genotype and Alzheimer's disease.
JAMA. 1997;278:13491356.[Abstract]
-
Blacker D, Haines JL, Rodes L, Terwedow H, Go RCP,
Harrell LE, Perry RT, Bassett SS, Chase G, Meyers D, Albert MS, Tanzi
R. ApoE-4 and age at onset of Alzheimer's disease: the NIMH
Genetics Initiative. Neurology. 1997;48:139147.[Abstract/Free Full Text]
-
Hofman A, Ott A, Breteler MMB, Bots ML, Slotter AJC,
van Harskamp F, van Duijn CN, Van Broeckhoven C, Grobbee DE.
Atherosclerosis, apolipoprotein E, and prevalence of
dementia and Alzheimer's disease in the Rotterdam Study.
Lancet. 1997;349:151154.[Medline]
[Order article via Infotrieve]
-
Fried LP, Borhani NO, Enright P, Furberg CD, Gardin JM,
Kronmal RA, Kuller LH, Manolio TA, Mittelmark MB, Newman A, O'Leary
DH, Psaty B, Rautaharju P, Tracy RP, Weiler PG, for the
Cardiovascular Health Study Research Group (CHS): the
Cardiovascular Health Study: Design and rationale.
Ann Epidemiol. 1991;1:263276.[Medline]
[Order article via Infotrieve]
-
Salthouse TA. The role of memory in the age decline in
digit symbol substitution performance. J Gerontol. 1978;33:232238.[Medline]
[Order article via Infotrieve]
-
Commenges D, Gagnon M, Letenneur L, Dartigues JF,
Barberger-Gateau P, Salamon R. Improving screening for dementia in the
elderly using Mini-Mental State Examination subscores, Benton's visual
retention test, and Isaacs' set test.
Epidemiology. 1992;3:185188.[Medline]
[Order article via Infotrieve]
-
Bryan RN, Wells SW, Miller TJ, Elster AD, Jungreis CA,
Poirier VC, Lind BK, Manolio TA. Infarct-like lesions in the brain:
prevalence and anatomic characteristics at MR imaging of the elderly:
data from the Cardiovascular Health Study.
Radiology. 1997;202:4754.[Abstract/Free Full Text]
-
Yue NC, Arnold AM, Longstreth WT, Elster AD, Jungreis
CA, O'Leary DH, Poirier VC, Bryan N. Sulcal, ventricular,
and white matter changes at MR imaging in the aging brain: data from
the Cardiovascular Health Study. Radiology. 1997;202:3339.[Abstract/Free Full Text]
-
Manolio TA, Kronmal RA, Burke GL, Poirier V, O'Leary
DH, Gardin JM, Fried LP, Steinberg EP, Bryan RN, for the
Cardiovascular Health Study Collaborative Research
Group. Magnetic resonance abnormalities and
cardiovascular disease in older adults: the
Cardiovascular Health Study. Stroke. 1994;25:318327.[Abstract]
-
Longstreth WT, Manolio TA, Arnold A, Burke GL, Bryan N,
Jungreis CA, Enright PL, O'Leary D, Fried L, for the
Cardiovascular Health Study Collaborative Research
Group. Clinical correlates of white matter findings on cranial magnetic
resonance imaging of 3301 elderly people: the
Cardiovascular Health Study. Stroke. 1996;27:12741282.[Abstract/Free Full Text]
-
Austin M, Ordovas J, Eckfeld J, Tracy R, Boerwinkle E,
Lalouel J-M, Printz M. Guidelines of the National Heart, Lung, and
Blood Institute Working Group on Blood Drawing, Processing and Storage
for Genetic Studies. Am J Epidemiol. 1996;144:437441.[Free Full Text]
-
Hixson J, Vernier D. Restriction isotyping of human
apolipoprotein E by gene amplification and cleavage with HhaI. J
Lipid Res. 1990;31:545548.[Abstract]
-
Kuller L, Borhani N, Furberg C, Gardin J, Manolio T,
O'Leary D, Psaty B, Robbins J. Prevalence of subclinical
atherosclerosis and cardiovascular
disease and association with risk factors in the
Cardiovascular Health Study. Am J
Epidemiol. 1994;139:11641179.[Abstract/Free Full Text]
-
Hosmer DW, Lemeshow S. Applied Logistic
Regression. Philadelphia: John Wiley & Sons, Inc; 1989.
-
Cauley JA, Eichner JE, Kamboh MI, Ferrell RE, Kuller
LH. Apo E allele frequencies in younger (age 4250) vs older
(6590) women. Genetic Epidemiol. 1993;10:2734.[Medline]
[Order article via Infotrieve]
-
Hyman BT, Gomez-Isla T, Briggs M, Chung H, Nichols S,
Kohout F, Wallace R. Apolipoprotein E and cognitive change in an
elderly population. Ann Neurol. 1996;40:5566.[Medline]
[Order article via Infotrieve]
-
APA. Diagnostic and Statistical
Manual of Mental Disorders. 4th ed. Washington, DC: American
Psychiatric Association; 1994:886.
-
Consensus Development Panel. Office of Medical
Application of Research, National Institutes of Health: differential
diagnosis of dementing diseases. JAMA. 1987;258:34113416.[Medline]
[Order article via Infotrieve]
-
Ganguli M, Belle S, Ratcliff G, Seaberg E, Hoff FJ, von
der Porten K, Kuller LH. Sensitivity and specificity for dementia of
population-based criteria for cognitive impairment: the MoVIES
Project. J Gerontol. 1993;48:M152M161.[Medline]
[Order article via Infotrieve]
-
Breitner JCS. New epidemiologic strategies in
Alzheimer's disease may provide clues to prevention and cause.
Neurobiol Aging. 1994;15:S175S177.
-
White L, Petrovitch H, Ross GW, Masaki KH, Abbott RD,
Teng EL, Rodriguez BL, Blanchette PL, Havlik RJ, Wergowske G, Chiu D,
Foley DJ, Murdaugh C, Curb JD. Prevalence of dementia in older
Japanese-American men in Hawaii: the Honolulu-Asia Aging
Study. JAMA. 1996;276:955960.[Abstract]
-
White L, Katzman R, Losonczy K, Salive M, Wallace R,
Berkman L, Taylor J, Fillenbaum G, Havlik R. Association of education
with incidence of cognitive impairment in three established populations
for epidemiologic studies of the elderly. J Clin
Epidemiol. 1994;47:363374.[Medline]
[Order article via Infotrieve]
-
Butler SM, Ashford JW, Snowdon DA. Age, education, and
changes in the mini-mental state exam scores of older women: findings
from the NUN Study. J Am Geriatr Soc. 1996;44:675681.[Medline]
[Order article via Infotrieve]
-
Stern Y, Gurland B, Tatemichi TK, Tang MX, Wilder D,
Mayeux R. Influence of education and occupation on the incidence of
Alzheimer's disease. JAMA. 1994;271:10041010.[Abstract]
-
Cobb JL, Wolf PA, Au R, White R, D'Agostino RB. The
effect of education on the incidence of dementia and
Alzheimer's disease in the Framingham Study.
Neurology. 1995;45:17071712.[Abstract/Free Full Text]
-
Mortimer JA, Graves AB. Education and other
socioeconomic determinants of dementia and Alzheimer's
disease. Neurology. 1993;43:S39S44.[Medline]
[Order article via Infotrieve]
-
Mortimer JA. What are the risk factors for dementia?
In: Huppert FA, Brayne C, O'Connor DW, eds. Dementia and Normal
Aging. New York: Cambridge University Press; 1994:208229.
-
Teresi JA, Golden RR, Cross P, Gurland B, Kleinman M,
Wilder D. Item bias in cognitive screening measures: comparisons of
elderly white, Afro-American, Hispanic and high and low education
subgroups. J Clin Epidemiol. 1995;48:473483.[Medline]
[Order article via Infotrieve]
-
Henderson AS, Sartorius N. International criteria and
differential diagnosis. In: Huppert FA, Brayne C, O'Connor DW, eds.
Dementia and Normal Aging. New York: Cambridge University
Press; 1994:7990.
-
Snowdon DA, Greiner LH, Mortimer JA, Riley KP, Greiner
PA, Markesbery WR. Brain infarction and the clinical expression of
Alzheimer disease: the NUN Study. JAMA. 1997;277:813817.[Abstract]
-
Tatemichi TK. How acute brain failure becomes chronic:
a view of the mechanisms of dementia related to stroke.
Neurology. 1990;40:16521659.[Free Full Text]
-
Tatemichi TK, Desmond DW, Mayeux R, Paik M, Stern Y,
Sano M, Remien RH, Williams JBW, Mohr JP, Hauser WA, Figueroa M.
Dementia after stroke: baseline frequency, risks, and clinical features
in a hospitalized cohort. Neurology. 1992;42:11851193.[Abstract/Free Full Text]
-
Ferrucci L, Guralnik JM, Salive ME, Pahor M, Corti M-C,
Baroni A, Havlik RJ. Cognitive impairment and risk of stroke in the
older population. J Am Geriatr Soc. 1996;44:237241.[Medline]
[Order article via Infotrieve]
-
Breteler MMB, Claus JJ, Grobbee DE, Hofman A.
Cardiovascular disease and distribution of cognitive
function in elderly people: the Rotterdam Study. BMJ. 1994;308:16041608.[Abstract/Free Full Text]
-
Tierney MC, Szalai JP, Snow WG, Fisher RH, Tsuda T, Chi
H, McLachlan DR, St. George-Hyslop PH. A prospective study of the
clinical utility of ApoE genotype in the prediction of outcome
in patients with memory impairment. Neurology. 1996;46:149154.[Abstract/Free Full Text]
-
Reiman EM, Caselli RJ, Yun LS, Chen K, Bandy D,
Minoshima S, Thibodeau SN, Osborne D. Preclinical evidence of
Alzheimer's disease in persons homozygous for the
4
allele for apolipoprotein E. N Engl J Med. 1996;334:752758.[Abstract/Free Full Text]
-
Reed T, Carmelli D, Swan GE, Breitner JCS, Welsh KA,
Jarvik GP, Deeb S, Auwerx J. Lower cognitive performance in
normal older adult male twins carrying the apolipoprotein E
4
allele. Arch Neurol. 1994;51:11891192.[Abstract]
-
Wilson PWF, Myers RH, Larson MG, Ordovas JM, Wolf PA,
Schaefer EJ. Apolipoprotein E alleles, dyslipidemia,
and coronary heart disease: the Framingham Offspring
Study. JAMA. 1994;272:16661671.[Abstract]
-
Eichner JE, Kuller LH, Orchard TJ, Grandits GA,
McCallum LM, Ferrell RE, Neaton JD. Relation of apolipoprotein E
phenotype to myocardial infarction and mortality from
coronary artery disease. Am J Cardiol. 1993;71:160165.[Medline]
[Order article via Infotrieve]
-
Kosunen O, Talasniemi S, Lehtovirta M, Heinonen O,
Helisalmi S, Mannermaa A, Paljarvi L, Ryynanen M, Riekkinen PJ,
Soininen H. Relation of coronary
atherosclerosis and apolipoprotein E genotypes
in Alzheimer patients. Stroke. 1995;26:743748.[Abstract/Free Full Text]
-
Slotter AJC, Tang MX, van Duijn CM, Stern Y, Ott A,
Bell K, Breteler MMB, Van Broeckhoven C, Tatemichi TK, Tycko B, Hofman
A, Mayeux R. Apolipoprotein E
4 and the risk of dementia with
stroke: a population-based investigation. JAMA. 1997;277:818821.[Abstract]
-
Kalmijn S, Feskens EJM, Launer LJ, Kromhout D.
Cerebrovascular disease, the apolipoprotein E4 allele, and
cognitive decline in a community-based study of elderly men.
Stroke. 1996;27:22302235.[Abstract/Free Full Text]
-
Canadian Study of Health, and Aging Working Group.
Canadian Study of Health and Aging: study methods and prevalence of
dementia. Can Med Assoc. 1994;150: