From the Departments of Neurology (S.J.K, B.R.F, R.F.M., T.R.P., M.A.S.,
M.A.W.) and Epidemiology and Preventive Medicine (S.J.K., R.J.M., T.R.P.,
M.A.S., P.D.S.), University of Maryland at Baltimore; the Departments of
Neurology (D.W.B., C.J.E., C.J.J., K.R.W., R.J.W.) and Medicine (P.J.G.-C.,
P.F.B.), Johns Hopkins University, Baltimore, Md; Cardiovascular Health
Branch, National Center for Chronic Disease Prevention and Health Promotion
(J.B.C., W.H.G.) and Division of Environmental Health Laboratory Sciences,
National Center for Environmental Health (V.K.B, C.-Y.O.), Centers for Disease
Control and Prevention, Atlanta, Ga; and the Department of Neurology (B.J.S.)
Emory University, Atlanta, Ga.
Correspondence to Steven J. Kittner, MD, MPH, Bressler Bldg, Room 12013, UMAB, 655 W Baltimore St, Baltimore, MD 21201. E-mail skittner{at}umabnet.ab.umd.edu
MethodsWe used a population-based case-control design to examine
the association of the GpIIIa polymorphism P1A2 with stroke in
young women. Subjects were 65 cerebral infarction cases (18 patients
with and 47 without an identified probable etiology) 15 to 44 years of
age from the Baltimore-Washington region and 122 controls frequency
matched by age from the same geographic area. A face-to-face interview
for vascular disease risk factors and a blood sample for the P1A2
allele and serum cholesterol were obtained from each
participant. Logistic regression was used to estimate the odds ratio
for one or more P1A2 alleles after adjustment for other risk
factors.
ResultsAmong cases and controls, the prevalence rates of one or
more P1A2 alleles were 21% and 22% among blacks and 36% and 28%
among whites, respectively. This genotype was significantly
associated with hypertension only in black control subjects but
otherwise not with any of the established vascular risk factors. The
adjusted odds ratio for cerebral infarction of one or more P1A2
alleles was 1.1 (confidence interval [CI], 0.6 to 2.3) overall,
0.5 (CI, 0.1 to 7.1) among blacks, and 1.4 (CI, 0.5 to 3.7) among
whites. For the cases with an identified probable etiology, the
corresponding odds ratios were 3.0 (CI, 0.9 to 10.4) overall, 0.7 (CI,
0.1 to 7.1) among blacks, and 12.8 (CI, 1.2 to 135.0) among whites.
ConclusionsNo association was found between the P1A2
polymorphism of GpIIIa and young women with stroke. However,
subgroup analyses showed that the P1A2 polymorphism of
GpIIIa appeared to be associated with stroke risk among white women,
particularly those with a clinically identified probable etiology for
their stroke. Further work with an emphasis on stroke subtypes and with
multiracial populations is warranted.
Platelet membrane glycoprotein IIb/IIIa
(GpIIb-IIIa) is a platelet membrane receptor and member of the
integrin family of adhesive molecules that, when activated,
binds fibrinogen and von Willebrand factor, thereby promoting
platelet aggregation and thrombosis.5 The
gene encoding the GpIIIa arm of the integrin molecule is
polymorphic at exon 3; the more common allele encodes a leucine
(P1A1), and the less common allele encodes a proline
(P1A2).6
Recently, the P1A2 allele of GpIIb-IIIa was reported to be an
inherited risk factor for acute coronary artery events,
specifically among younger white adults in
some7 8 but not all9
reports. There have been two reports showing no association of this
polymorphism with stroke,9 10 but neither
study focused on young adults.
We postulated that the platelet polymorphism P1A2 may be a
hereditary risk factor for cerebral infarction in young adults. We
examined this hypothesis in a population-based case-control study in
young women in the Baltimore-Washington area in analyses among
both whites and blacks and for cases with and without a clinically
identified probable etiology.
The group without an identified probable underlying cause for stroke
was composed of cases with a possible underlying cause (n=25) and cases
with no identified probable or possible cause (n=22). The possible
causes were equivocal cardioembolic sources of embolism (n=6), which
included 1 case with recent illicit drug use and 1 with a possible
contributing hematologic cause; lacunes (n=5), which included 1 case
with a possible contributing role for migraine and 1 with an equivocal
cardioembolic source; recent illicit drug use (n=4); possible
migrainous stroke (n=3), including 2 cases with concurrent oral
contraceptive use; atherosclerosis (
Case patients were also classified as having large-vessel extracranial
disease or intracranial disease (n=36), small-vessel disease (n=6), or
indeterminate (n=23), a category that included more than one vessel
type, based on both clinical and radiological features.
Control subjects were women without a history of stroke, frequency
matched by age and geographic region of residence to the cases,
identified by random-digit dialing.
The P1A genotyping for the GpIIIa polymorphism was performed as
follows: Genomic DNA was isolated from 0.2 mL frozen whole blood with a
QIAmp blood isolation kit
(Qiagen)* according to the
manufacturer's recommendations and eluted with 200 µL Tris HCl (pH
8.0). Five microliters of purified DNA was used in a polymerase chain
reaction containing primers (5' ttctgattgctggacttctctt 3' and 5'
tctctccccatggcaaagagt 3') in a final volume of 50 µL to yield a 266
bp DNA product.12 One tenth (5 µL) of the
amplified DNA was digested to completion with restriction endonuclease
Msp-I (Promega) and electrophoresed in a 10% polyacrylamide
gel to generate three genotype-related patterns as described by
Weiss et al.7 DNA specimens corresponding to all
three genotypes that had been verified by DNA sequencing were
included in the laboratory genotyping process as controls. Genotyping
was performed by laboratory personnel blinded to the protocol, and each
sample was examined two or more times with concordant genotype
results. Furthermore, independent confirmation of genotypes was
obtained by blinded analysis of a subset of samples in the
laboratory of P.G.-C. and P.B. with use of reverse dot blot
hybridization and by Msp-I restriction endonuclease, assay as
previously described.13 Only four study
participants were homozygous for the P1A2 allele (3 case patients
and 1 control subject). Because of the small number of homozygotes and
because there is evidence that heterozygotes are also associated with
increased vascular risk,7 the homozygous and
heterozygous groups were combined.
Potential confounders of the association between the P1A2 alleles
and stroke included age, race, hypertension, diabetes mellitus, high
blood cholesterol, and cigarette smoking. Hypertension and
diabetes mellitus were determined by asking study participants (or the
proxy, if a participant was unable to answer) if they had ever been
told by a physician that they had the condition. Similarly, age, race,
and current smoking status were determined by subject or proxy report.
Cholesterol was measured according to standard
practice,14 with
t tests were used to compare means and
The case patients were more likely to have traditional vascular disease
risk factors than were the controls; if these factors were also
associated with the P1A2 allele, these factors could confound the
relationship between the P1A2 allele and stroke. Table 2
Table 3
Table 4
Cases without an identified probable underlying cause of cerebral
infarction were also examined in race-stratified analyses and
did not show an association between genotype and risk for
stroke (data not shown).
Among cases classified as having an intracranial or extracranial
large-vessel stroke (n=36), the adjusted ORs were 0.7 (95% CI, 0.2 to
1.8) overall, 1.3 (95% CI, 0.3 to 4.8) for whites, and 0.1 (95% CI,
0.01 to 1.6) for blacks. The limited number of small-vessel strokes
(n=6) precluded meaningful analyses in this subgroup. Among
cases classified as having an indeterminate or mixed vessel type
(n=23), the adjusted ORs were 2.4 (95% CI, 0.9 to 6.5) overall, 3.1
(95% CI, 0.7 to 13.3) for whites, and 1.5 (95% CI, 0.3 to 6.9) for
blacks.
It is known that the P1A2 allele is less prevalent in black than in
white populations (16% versus 20% with one or more
alleles),16 but prior studies of the
association of P1A2 with thrombotic events have not included blacks.
Among black control subjects, we noted an increased prevalence of P1A2
positivity in those with hypertension. However, since our data do not
support an association of the P1A2 allele with stroke in young
black women, further studies will be needed to clarify the role of P1A2
in stroke and hypertension among blacks.
Prior research on the relation of the P1A2 allele to vascular
disease has shown varying results. The original observation by Weiss
and coworkers7 from Baltimore among 71 white men
with myocardial infarction or unstable angina and 68 inpatient controls
showed a P1A2 prevalence of 39.4% among the cases and 19.1% among the
controls. The overall association was predominantly due to the effect
among the 42 patients under 60 years of age, where this allele had
a prevalence of 50% and was 3.6 times more frequent in patients than
among controls.7 These observations were
supported by a report by Carter et al8 from
Leeds, England, where the P1A2 allele was found in 50% of 24 white
men with myocardial infarction before age 47 and in 27% of 45
age-matched controls. In contrast, a report based on men in the
Physicians' Health Study9 17 failed to show an
association between the AlA2 allele and myocardial infarction
(n=374), ischemic stroke (n=146), or venous thromboembolism
(n=121). No association was evident even when the analysis was
limited to patients younger than 60 years of age. Carlsson and
coworkers10 found no difference in the prevalence
of P1A2 or other human platelet antigen polymorphisms between
218 patients with ischemic stroke or transient ischemic
attacks and 165 neurological inpatients without acute or recent signs
of cerebrovascular disease and 321 healthy blood donors. The mean age
of the patients with cerebral ischemia was 62.1 years;
analyses were not stratified by age.
These disparate results can be considered in the context of the
several different explanations for an association of a genetic marker
with disease.18 First, the marker allele may
be a part of the pathological process and define a susceptibility
locus. The role of GpIIb-IIIa as a platelet membrane receptor that
binds fibrinogen and von Willebrand factor provides a
biological rationale for this possibility.5
Second, the marker allele may not cause the trait but may be in
linkage disequilibrium with an unobserved "high-risk" allele at
a different susceptibility locus. Linkage disequilibrium is a function
of the history of the population, and thus true associations due to
linkage disequilibrium can occur in one population and not in another.
Third, positive associations can also occur as an artifact of
population admixture. There may be confounding between unrecognized
subgroups of the population, in which both the marker allele
frequency and the disease prevalence differ across strata of the
population. Confounding may also obscure the presence of a
susceptibility locus or linkage to such a locus. This potential problem
may be expressed in different ways in different populations. Therefore,
the disparate results among studies of the association of the P1A2
allele with disease may be due to linkage disequilibrium,
confounding by population admixture, or age differences. Our
population-based case-control design with analysis stratified
by race was intended to minimize the problem of population
admixture.
A limitation of our study is the small sample size, which
increases the likelihood of both type 1 and type 2 errors. Because
stroke in the young is uncommon, it is difficult to obtain a large
population-based patient group for a case-control study. Ours is the
only study of the P1A2 allele in a multiracial population of young
women. Our results are promising, because the wide confidence intervals
do not exclude the possibility of an OR in the range of 2 to 4 for the
overall group. Similarly, the strong effect among the subgroup of white
women with an identified probable cause, while statistically
significant, also had wide confidence intervals and will require
replication.
The formation of a platelet clot requires the binding of fibrinogen
and von Willebrand factor to its receptor, GpIIb-IIIa, on the
platelet surface.5 Antiplatelet therapy
has been a mainstay of both primary and secondary stroke prevention.
This therapy has included aspirin, which inhibits platelet
cyclooxygenase and thromboxane A2
production, and ticlopidine, which inhibits ADP activation of
GpIIb-IIIa.19 20 Other antiplatelet agents
that selectively inhibit the Gp receptor have been
developed.21 P1A2 is a highly prevalent
polymorphism in both whites and blacks. Confirmation that this
allele affects susceptibility to stroke would raise the prospect of
stroke prevention efforts specific to genotype status. Further
work in this area with an emphasis on stroke subtypes and with
multiracial populations is warranted.
The authors would like to acknowledge the assistance of the
following individuals who have sponsored the Stroke Prevention in Young
Women Study at their institution: Frank Anderson, MD; Clifford Andrew,
MD, PhD; Christopher Bever, MD; Nicholas Buendia, MD; Young Ja Cho, MD;
James Christensen, MD; Remzi Demir, MD; Terry Detrich, MD; John
Eckholdt, MD; Nirmala Fernback, MD; Jerold Fleishman, MD; Benjamin
Frishberg, MD; Stuart Goodman, MD, PhD; Norman Hershkowitz, MD, PhD;
Luke Kao, MD, PhD; Mehrullah Khan, MD; Ramesh Khurana, MD; John
Kurtzke, MD; William Leahy, MD; William Lightfoote II, MD; Bruce Lobar,
MD; Michael Miller, MD, PhD; Harshad Mody, MBBS; Marvin Mordes, MD;
Seth Morgan, MD; Howard Moses, MD; Sivarama Nandipati, MD; Mark Ozer,
MD; Roger Packer, MD; Thaddeus Pula, MD; Philip Pulaski, MD; Naghbushan
Rao, MD; Marc Raphaelson, MD; Solomon Robbins, MD; David Satinsky, MD;
Elijah Saunders, MD; Michael Sellman, MD, PhD; Arthur Siebens, MD
(deceased); Harold Stevens, MD, PhD; Dean Tippett, MD; Roger Weir, MD;
Michael Weinrich, MD; Richard Weisman, MD; Don Wood, MD (deceased); and
Mohammed Yaseen, MD.
In addition, the study could not have been completed without the
support from the administration and medical records staff at the
following institutions. Maryland: Anne Arundel Medical
Center, Atlantic General Hospital, Bon Secours Hospital, Calvert
Memorial Hospital, Carroll County General, Church Hospital Corporation,
Doctors Community Hospital, Fallston General Hospital, Franklin Square
Hospital Center, Frederick Memorial Hospital, The Good Samaritan
Hospital of Maryland Inc, Greater Baltimore Medical Center, Harbor
Hospital Center, Harford Memorial Hospital, Holy Cross Hospital, Johns
Hopkins Bayview Inc, The Johns Hopkins Hospital, Howard County General
Hospital Inc, Kennedy Krieger Institute, Kent and Queen Anne Hospital,
Laurel Regional Hospital, Liberty Medical Center Inc, Maryland General
Hospital, McCready Memorial Hospital, Memorial Hospital at Easton,
Mercy Medical Center, Montebello Rehabilitation Hospital, Montgomery
General Hospital, North Arundel Hospital, Northwest Hospital Center,
Peninsula Regional Medical Center, Physician's Memorial Hospital,
Prince George's Hospital Center, Saint Agnes Hospital, Saint Joseph
Hospital, Saint Mary's Hospital, Shady Grove Adventist Hospital, Sinai
Hospital of Baltimore, Southern Maryland Hospital Center, Suburban
Hospital, The Union Memorial Hospital, University of Maryland Medical
System, Department of Veterans Affairs Medical Center in Baltimore,
Washington Adventist Hospital, and Washington County Hospital.
Washington, DC: Children's National Medical Center,
District of Columbia General Hospital, The George Washington University
Medical Center, Georgetown University Hospital, Greater
Southeast Community Hospital, Hadley Memorial Hospital, Howard
University Hospital, National Rehabilitation Hospital, Providence
Hospital, Sibley Memorial Hospital, Veterans Affairs Medical Center,
and The Washington Hospital Center. Pennsylvania: Gettysburg
Hospital and Hanover General Hospital.
Received November 7, 1997;
accepted January 7, 1998.
2.
Khaw K, Barrett-Connor E. Family history of stroke as
an independent predictor of ischemic heart disease in men and
stroke in women. Am J Epidemiol. 1986;123:5966.
3.
Welin L, Svardsudd K, Wilhelmsen L, Larsson B, Tibblin
G. Analysis of risk factors for stroke in a cohort of men born
in 1913. N Engl J Med. 1987;317:521526.[Abstract]
4.
Carrieri PB, Orefice G, Maiorino A, Provitera V,
Balzano G, Lucariello A. Age-related risk factors for ischemic
stroke in Italian men.
Neuroepidemiology. 1994;13:2833.[Medline]
[Order article via Infotrieve]
5.
Phillips DR, Charo IF, Parise LV, Fitzgerald LA. The
platelet membrane glycoprotein IIb-IIIa complex.
Blood. 1988;71:831843.
6.
Newman PJ, Derbes RS, Aster RH. The human platelet
alloantigens PIA1 and PIA2 are associated with a leucine 33/proline 33
amino acid polymorphism in membrane glycoprotein IIIa
and are distinguishable by DNA typing. J Clin Invest. 1989;83:17781781.
7.
Weiss EJ, Bray PF, Tayback M, Schulman SP, Kickler TS,
Becker LC, Weiss JL, Gerstenblith G, Goldschmidt-Clermont PJ. A
polymorphism of a platelet glycoprotein receptor as
an inherited risk factor for coronary thrombosis. N
Engl J Med. 1996;334:10901094.
8.
Carter AM, Ossei-Gerning N, Grant PJ.
Platelet Glycoprotein IIIa P1A polymorphism in
young men with myocardial infarction. Lancet. 1996;348:485486.[Medline]
[Order article via Infotrieve]
9.
Ridker PM, Hennekens CH, Schmitz C, Stampfer MJ,
Lindpainter K. P1A1/A2 polymorphism of platelet
glycoprotein IIIa and risks of myocardial infarction,
stroke, and venous thrombosis. Lancet. 1997;349:385388.[Medline]
[Order article via Infotrieve]
10.
Carllsson LE, Greinacher A, Spitzer C, Walther R,
Kessler C. Polymorphisms of the human platelet antigens HPA-1,
HPA-2, HPA-3, and HPA-5 on the platelet receptors for fibrinogen
(GPIIb/IIIa), von Willebrand factor (GPIb/IX), and collagen
(GPIa/IIa) are not correlated with an increased risk of stroke.
Stroke. 1997;28:13921395.
11.
Kittner SJ, Stern BJ, Feeser BR, Hebel JR, Nagey DA,
Buchholz DW, Early CJ, Johnson CJ, Macko RF, Sloan MA, et al. Pregnancy
and the risk of stroke. N Engl J Med. 1996;335:768774.
12.
Jin Y, Dietz HC, Nurden A, Bray PF. Single-strand
conformation polymorphism analysis is a rapid and effective
method for identification of mutations and polymorphisms in the
gene for glycoprotein IIIa. Blood. 1993;82:22812288.
13.
Bray PF, Jin Y, Kichler T. Rapid genotyping of the five
major platelet alloantigens by reverse dot-blot hybridization.
Blood. 1994;84:43614367.
14.
Fundamentals of Clinical Chemistry.
Philadelphia, Pa: WB Saunders. 1976.
15.
Zuber M, Toulon P, Marnet L, Mas JL. Factor V Leiden
mutation in cerebral venous thrombosis. Stroke. 1996;27:17211723.
16.
Kim H, Jin Y, Kickler TS, Blakemore K, Kwon OH, Bray
PF. Gene frequencies of the five majors human platelet antigens in
African-American, white and Korean populations. Transfusion. 1995;35:865867.
17.
Ridker PM. P1A1/A2 polymorphism of platelet
glycoprotein IIIa and risk of
cardiovascular disease. Lancet. 1997;349:385388.
18.
Lander ES, Shork NJ. Genetic dissection of complex
traits. Science. 1994;265:20372048.
19.
Fitzgerald GA, Meagher EA. Antiplatelet drugs.
Eur J Clin Invest. 1994;24(suppl):4649.
20.
Haynes RB, Sandler RS, Larson EB. A critical appraisal
of ticlopidine, a new antiplatelet agent. Effectiveness and
clinical indications for prophylaxis of atherosclerotic events.
Arch Intern Med. 1992;152:13761380.
21.
Lefkovits J, Plow EF, Topol EJ. Platelet
glycoprotein Ib/IIIa receptors in
cardiovascular medicine. N Engl J Med. 1995;332:15531559.
© 1998 American Heart Association, Inc.
Original Contributions
Platelet Glycoprotein Receptor IIIa Polymorphism P1A2 and Ischemic Stroke Risk
The Stroke Prevention in Young Women Study
![]()
Abstract
Top
Abstract
Introduction
Subjects and Methods
Results
Discussion
References
Background and
PurposePlatelet glycoprotein IIb/IIIa
(GpIIb-IIIa), a membrane receptor for fibrinogen and von
Willebrand factor, has been implicated in the pathogenesis of
acute coronary syndromes but has not been previously
investigated in relation to stroke in young adults.
Key Words: cerebrovascular disorders platelets polymorphism (genetics) young adults women
![]()
Introduction
Top
Abstract
Introduction
Subjects and Methods
Results
Discussion
References
Cerebral infarction
in young adults is etiologically diverse,1 and a
large number of risk factors have been identified, including older age,
black race, hypertension, diabetes mellitus,
hypercholesterolemia, and cigarette smoking.
Family history of stroke has also been implicated as a risk
factor2 3 4 ; however, few genetic risk factors for
ischemic stroke have been established.
![]()
Subjects and Methods
Top
Abstract
Introduction
Subjects and Methods
Results
Discussion
References
The Stroke Prevention in Young Women Study is a population-based
case-control study in the Baltimore-Washington area initiated to study
risk factors for ischemic stroke in young women. P1A genotyping
was performed in a total of 65 case patients and 122 control subjects.
Cases were female patients 15 to 44 years of age with a first cerebral
infarction, identified by discharge surveillance at 59 regional
hospitals and through direct referral by regional neurologists. The
methods for discharge surveillance, chart abstraction, case
adjudication, and assignment of probable and possible underlying causes
have been described previously.1 11 Using
published criteria,1 the case subjects were
divided into two mutually exclusive groups: patients with an identified
probable underlying cause for their stroke (n=18) and those without an
identified probable underlying cause (n=47). The group with an
identified probable underlying cause for stroke was composed of
patients with atherosclerosis (>60% ipsilateral
stenosis) (n=6); cardiac or transcardiac emboli
(n=5); nonatherosclerotic vasculopathy, which included
cocaine-associated cerebral infarction with no alternate cause,
dissection, Takayasu's arteritis, and other vasculitides (n=4); and
hematologic disorders, which included antithrombin III deficiency,
sickle cell thalassemia with history of recent crisis,
cancer-associated hypercoagulable state, and thrombotic
thrombocytopenic purpura (n=4). One patient had both an atherosclerotic
and an embolic source for her stroke.
60%
stenosis) (n=3); pregnancy-associated stroke (n=2); and oral
contraceptive use (n=2).
200 mg/dL considered a high
blood cholesterol level.
2 tests to compare proportions. All
probability values were two sided. Adjusted ORs derived from logistic
regression were used to determine whether the presence of the P1A2
allele was associated with an increased risk for stroke after
controlling for differences in age, race, hypertension, diabetes
mellitus, high blood cholesterol, and cigarette smoking
status.
![]()
Results
Top
Abstract
Introduction
Subjects and Methods
Results
Discussion
References
Table 1
compares women with a first
cerebral infarction and control subjects with respect to the major
known vascular risk factors. Cases and controls were matched for age.
Cases were more likely than controls to be black (49.2% versus
37.2%), were significantly more likely to have hypertension and
diabetes, and tended to have higher cholesterol levels and
higher cigarette smoking rates. The risk-factor profile of persons with
stroke due to an identified probable underlying cause was similar to
that for all strokes (mean age, 36.5 years; black race, 44.4%; history
of high blood pressure, 33.3%; diabetes mellitus, 33.3%; high blood
cholesterol level, 50%; former smoker, 16.7%; and current
smoker, 55.6%).
View this table:
[in a new window]
Table 1. Baseline Characteristics of Study Participants
examines the association between the
risk factors described above and the P1A2 allele among controls,
stratified by race. Hypertension was associated with the P1A2
allele among blacks only (P=.015); no other associations
achieved statistical significance.
View this table:
[in a new window]
Table 2. Prevalence of One or More P1A2 Alleles According
to Selected Characteristics
examines the association
between genotype and cerebral infarction, overall and
stratified by race. Among the cases and controls, the P1A2
polymorphism was slightly more prevalent in whites (36% and 28%,
respectively) than in blacks (21% and 22%, respectively). After
adjustment for differences in age, race, hypertension, diabetes
mellitus, high cholesterol and current smoking status, the
presence of at least one P1A2 allele conferred an OR for stroke of
1.1 (95% CI, 0.6 to 2.3). In addition, there was a suggestion that the
P1A2 allele is a stronger risk factor for stroke among whites (OR,
1.4) than among blacks (OR, 0.5).
View this table:
[in a new window]
Table 3. Presence of One or More A2 Alleles and Risk of
Cerebral Infarction
examines the association between
genotype and stroke among young women in the subset with an
identified probable underlying cause of cerebral infarction (n=18).
Compared with the controls, these cases had a substantially higher
prevalence of the PIA2 allele (50% versus 25%). The presence of
the allele was associated with a threefold increased risk for
stroke adjusted for other factors (95% CI, 0.9 to 10.4). This
increased risk was exclusively due to the stronger association among
white women (adjusted OR, 12.8; 95% CI, 1.2 to 135.0). In contrast to
these findings among whites, the P1A2 allele was not associated
with an increased risk of stroke among blacks (adjusted OR, 0.7; 95%
CI, 0.1 to 7.1).
View this table:
[in a new window]
Table 4. Presence of One or More A2 Alleles and Risk for
Cerebral Infarction in Cases With an Identified Probable Cause for
Stroke
![]()
Discussion
Top
Abstract
Introduction
Subjects and Methods
Results
Discussion
References
This study of stroke in young women did not show a
significant association between P1A2 and all cerebral infarctions.
Subgroup analyses, performed with a previously published
classification system1 indicated more of an
effect among stroke cases with an identified probable etiology than
among those with no identified probable etiology. P1A2 has been
reported to be associated with cardiac
disease,7 8 almost exclusively a large-vessel
process. However, our data do not support an effect predominantly among
large-vessel strokes. Compared with MI, stroke is a more
heterogeneous process, with multiple etiologies. We could
identify an association between P1A2 and stroke of diverse identified
causes, including atherosclerosis, cardiac emboli,
nonatherosclerotic vasculopathy, and hematologic conditions. This
suggests that the P1A2 allele could interact with other conditions
predisposing to stroke, analogous to the effect of the factor V Leiden
mutation on the risk of cerebral venous
thrombosis.15 Women with a condition strongly
predisposing to stroke may be more likely to have a stroke at an
earlier age if they have the P1A2 allele than women without the
allele.
![]()
Acknowledgments
Supported in part by a clinical stroke research
center award (NS1633211) from the National Institute of Neurological
Disorders and Stroke. We are indebted to Chad H. Richardson for his
outstanding technical assistance and to the following members of the
Stroke Prevention in Young Women research team for their dedication:
Anne Epstein, James Gardner, Mary Keiser, Ann Maher, Jennifer Rohr,
Mary J. Seipp, Susan Snyder, Mary J. Sparks, and Nancy
Zappala.
![]()
References
Top
Abstract
Introduction
Subjects and Methods
Results
Discussion
References
1.
Johnson CJ, Kittner SJ, McCarter RJ, Sloan MA,
Stern BJ, Buchholz D, Price TR. Interrater reliability of an etiologic
classification of ischemic stroke. Stroke. 1995;26:4651.
This article has been cited by other articles:
![]() |
S. Debette and S. Seshadri Genetics of Atherothrombotic and Lacunar Stroke Circ Cardiovasc Genet, April 1, 2009; 2(2): 191 - 198. [Full Text] [PDF] |
||||
![]() |
T. CHIRAS, E. D. PAPADAKIS, A. KATOPODI, E. CHATZIANESTI, K. FOURTOUNAS, S. PAPAKONSTANTINOU, I. THEODOROPOULOS, A. DAKOURAS, N. ZEREFOS, D. VALIS, et al. Platelet GP IIIA Polymorphism HPA-1 (PLA1/2) Is Associated with Hypertension as the Primary Cause for End-stage Renal Disease in Hemodialysis Patients from Greece In Vivo, January 1, 2009; 23(1): 177 - 181. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K.J. Oksala, M. Heikkinen, J. Mikkelsson, T. Pohjasvaara, M. Kaste, T. Erkinjuntti, and P. J. Karhunen Smoking and the Platelet Fibrinogen Receptor Glycoprotein IIb/IIIA PlA1/A2 Polymorphism Interact in the Risk of Lacunar Stroke and Midterm Survival Stroke, January 1, 2007; 38(1): 50 - 55. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Bushnell, P. Hurn, C. Colton, V. M. Miller, G. del Zoppo, M. S.V. Elkind, B. Stern, D. Herrington, G. Ford-Lynch, P. Gorelick, et al. Advancing the Study of Stroke in Women: Summary and Recommendations for Future Research From an NINDS-Sponsored Multidisciplinary Working Group Stroke, September 1, 2006; 37(9): 2387 - 2399. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Wiwanitkit PIA1/A2 Polymorphism of the Platelet Glycoprotein Receptor IIb/IIIIa and Its Correlation With Myocardial Infarction: An Appraisal Clinical and Applied Thrombosis/Hemostasis, January 1, 2006; 12(1): 93 - 95. [Abstract] [PDF] |
||||
![]() |
L. Anderson Candidate-based proteomics in the search for biomarkers of cardiovascular disease J. Physiol., February 15, 2005; 563(1): 23 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Casas, A. D. Hingorani, L. E. Bautista, and P. Sharma Meta-analysis of Genetic Studies in Ischemic Stroke: Thirty-two Genes Involving Approximately 18 000 Cases and 58 000 Controls Arch Neurol, November 1, 2004; 61(11): 1652 - 1661. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gwinn-Hardy and V. Dawson Genomics-Proteomics and Stroke: Introduction Stroke, November 1, 2004; 35(11_suppl_1): 2731 - 2734. [Full Text] [PDF] |
||||
![]() |
A. Slowik, T. Dziedzic, W. Turaj, J. Pera, L. Glodzik-Sobanska, P. Szermer, M. T. Malecki, D. A. Figlewicz, and A. Szczudlik A2 Alelle of GpIIIa Gene Is a Risk Factor for Stroke Caused by Large-Vessel Disease in Males Stroke, July 1, 2004; 35(7): 1589 - 1593. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Voetsch and J. Loscalzo Genetic Determinants of Arterial Thrombosis Arterioscler. Thromb. Vasc. Biol., February 1, 2004; 24(2): 216 - 229. [Abstract] [Full Text] |
||||
![]() |
S. J. Kittner Stroke in the young: Coming of age Neurology, July 9, 2002; 59(1): 6 - 7. [Full Text] [PDF] |
||||
![]() |
J.Y. Streifler, N. Rosenberg, A. Chetrit, R. Eskaraev, B.A. Sela, R. Dardik, A. Zivelin, B. Ravid, J. Davidson, U. Seligsohn, et al. Cerebrovascular Events in Patients With Significant Stenosis of the Carotid Artery Are Associated With Hyperhomocysteinemia and Platelet Antigen-1 (Leu33Pro) Polymorphism Stroke, December 1, 2001; 32(12): 2753 - 2758. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.J. Hademenos, M.J. Alberts, I. Awad, M. Mayberg, T. Shephard, A. Jagoda, R.E. Latchaw, H.W. Todd, K. Viste, R. Starke, et al. Advances in the genetics of cerebrovascular disease and stroke Neurology, April 24, 2001; 56(8): 997 - 1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
T C F Sykes, C Fegan, and D Mosquera Thrombophilia, polymorphisms, and vascular disease Mol. Pathol., December 1, 2000; 53(6): 300 - 306. [Abstract] [Full Text] |
||||
![]() |
A. Hassan and H. S. Markus Genetics and ischaemic stroke Brain, September 1, 2000; 123(9): 1784 - 1812. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Reiner, P. N. Kumar, S. M. Schwartz, W. T. Longstreth Jr, R. M. Pearce, F. R. Rosendaal, B. M. Psaty, and D. S. Siscovick Genetic Variants of Platelet Glycoprotein Receptors and Risk of Stroke in Young Women Stroke, July 1, 2000; 31(7): 1628 - 1633. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sonoda, M. Murata, D. Ito, N. Tanahashi, A. Ohta, Y. Tada, E. Takeshita, T. Yoshida, I. Saito, M. Yamamoto, et al. Association Between Platelet Glycoprotein Ib{alpha} Genotype and Ischemic Cerebrovascular Disease Stroke, February 1, 2000; 31(2): 493 - 497. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Stroke Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |