Donate Help Contact The AHA Sign In Home
American Heart Association
Stroke
Search: search_blue_button Advanced Search
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wagner, K. R.
Right arrow Articles by Kittner, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wagner, K. R.
Right arrow Articles by Kittner, S. J.

(Stroke. 1998;29:581-585.)
© 1998 American Heart Association, Inc.


Original Contributions

Platelet Glycoprotein Receptor IIIa Polymorphism P1A2 and Ischemic Stroke Risk

The Stroke Prevention in Young Women Study

Kathryn R. Wagner, MD, PhD; Wayne H. Giles, MD, MS; Constance J. Johnson, MD, MS; Chin-Yih Ou, PhD; Paul F. Bray, MD; Pascal J. Goldschmidt-Clermont, MD; Janet B. Croft, PhD; Vicki K. Brown, MMSc; Barney J. Stern, MD; Barbara R. Feeser, MPH, MBA; David W. Buchholz, MD; Christopher J. Earley, MD, PhD; Richard F. Macko, MD; Robert J. McCarter, ScD; Michael A. Sloan, MD; Paul D. Stolley, MD, MPH; Robert J. Wityk, MD; Marcella A. Wozniak, MD, PhD; Thomas R. Price, MD; Steven J. Kittner, MD, MPH

From the Departments of Neurology (S.J.K, B.R.F, R.F.M., T.R.P., M.A.S., M.A.W.) and Epidemiology and Preventive Medicine (S.J.K., R.J.M., T.R.P., M.A.S., P.D.S.), University of Maryland at Baltimore; the Departments of Neurology (D.W.B., C.J.E., C.J.J., K.R.W., R.J.W.) and Medicine (P.J.G.-C., P.F.B.), Johns Hopkins University, Baltimore, Md; Cardiovascular Health Branch, National Center for Chronic Disease Prevention and Health Promotion (J.B.C., W.H.G.) and Division of Environmental Health Laboratory Sciences, National Center for Environmental Health (V.K.B, C.-Y.O.), Centers for Disease Control and Prevention, Atlanta, Ga; and the Department of Neurology (B.J.S.) Emory University, Atlanta, Ga.

Correspondence to Steven J. Kittner, MD, MPH, Bressler Bldg, Room 12–013, UMAB, 655 W Baltimore St, Baltimore, MD 21201. E-mail skittner{at}umabnet.ab.umd.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowSubjects and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background and Purpose—Platelet glycoprotein IIb/IIIa (GpIIb-IIIa), a membrane receptor for fibrinogen and von Willebrand factor, has been implicated in the pathogenesis of acute coronary syndromes but has not been previously investigated in relation to stroke in young adults.

Methods—We used a population-based case-control design to examine the association of the GpIIIa polymorphism P1A2 with stroke in young women. Subjects were 65 cerebral infarction cases (18 patients with and 47 without an identified probable etiology) 15 to 44 years of age from the Baltimore-Washington region and 122 controls frequency matched by age from the same geographic area. A face-to-face interview for vascular disease risk factors and a blood sample for the P1A2 allele and serum cholesterol were obtained from each participant. Logistic regression was used to estimate the odds ratio for one or more P1A2 alleles after adjustment for other risk factors.

Results—Among cases and controls, the prevalence rates of one or more P1A2 alleles were 21% and 22% among blacks and 36% and 28% among whites, respectively. This genotype was significantly associated with hypertension only in black control subjects but otherwise not with any of the established vascular risk factors. The adjusted odds ratio for cerebral infarction of one or more P1A2 alleles was 1.1 (confidence interval [CI], 0.6 to 2.3) overall, 0.5 (CI, 0.1 to 7.1) among blacks, and 1.4 (CI, 0.5 to 3.7) among whites. For the cases with an identified probable etiology, the corresponding odds ratios were 3.0 (CI, 0.9 to 10.4) overall, 0.7 (CI, 0.1 to 7.1) among blacks, and 12.8 (CI, 1.2 to 135.0) among whites.

Conclusions—No association was found between the P1A2 polymorphism of GpIIIa and young women with stroke. However, subgroup analyses showed that the P1A2 polymorphism of GpIIIa appeared to be associated with stroke risk among white women, particularly those with a clinically identified probable etiology for their stroke. Further work with an emphasis on stroke subtypes and with multiracial populations is warranted.


Key Words: cerebrovascular disorders • platelets • polymorphism (genetics) • young adults • women


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowSubjects and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cerebral infarction in young adults is etiologically diverse,1 and a large number of risk factors have been identified, including older age, black race, hypertension, diabetes mellitus, hypercholesterolemia, and cigarette smoking. Family history of stroke has also been implicated as a risk factor2 3 4 ; however, few genetic risk factors for ischemic stroke have been established.

Platelet membrane glycoprotein IIb/IIIa (GpIIb-IIIa) is a platelet membrane receptor and member of the integrin family of adhesive molecules that, when activated, binds fibrinogen and von Willebrand factor, thereby promoting platelet aggregation and thrombosis.5 The gene encoding the GpIIIa arm of the integrin molecule is polymorphic at exon 3; the more common allele encodes a leucine (P1A1), and the less common allele encodes a proline (P1A2).6

Recently, the P1A2 allele of GpIIb-IIIa was reported to be an inherited risk factor for acute coronary artery events, specifically among younger white adults in some7 8 but not all9 reports. There have been two reports showing no association of this polymorphism with stroke,9 10 but neither study focused on young adults.

We postulated that the platelet polymorphism P1A2 may be a hereditary risk factor for cerebral infarction in young adults. We examined this hypothesis in a population-based case-control study in young women in the Baltimore-Washington area in analyses among both whites and blacks and for cases with and without a clinically identified probable etiology.


*    Subjects and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Subjects and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The Stroke Prevention in Young Women Study is a population-based case-control study in the Baltimore-Washington area initiated to study risk factors for ischemic stroke in young women. P1A genotyping was performed in a total of 65 case patients and 122 control subjects. Cases were female patients 15 to 44 years of age with a first cerebral infarction, identified by discharge surveillance at 59 regional hospitals and through direct referral by regional neurologists. The methods for discharge surveillance, chart abstraction, case adjudication, and assignment of probable and possible underlying causes have been described previously.1 11 Using published criteria,1 the case subjects were divided into two mutually exclusive groups: patients with an identified probable underlying cause for their stroke (n=18) and those without an identified probable underlying cause (n=47). The group with an identified probable underlying cause for stroke was composed of patients with atherosclerosis (>60% ipsilateral stenosis) (n=6); cardiac or transcardiac emboli (n=5); nonatherosclerotic vasculopathy, which included cocaine-associated cerebral infarction with no alternate cause, dissection, Takayasu's arteritis, and other vasculitides (n=4); and hematologic disorders, which included antithrombin III deficiency, sickle cell thalassemia with history of recent crisis, cancer-associated hypercoagulable state, and thrombotic thrombocytopenic purpura (n=4). One patient had both an atherosclerotic and an embolic source for her stroke.

The group without an identified probable underlying cause for stroke was composed of cases with a possible underlying cause (n=25) and cases with no identified probable or possible cause (n=22). The possible causes were equivocal cardioembolic sources of embolism (n=6), which included 1 case with recent illicit drug use and 1 with a possible contributing hematologic cause; lacunes (n=5), which included 1 case with a possible contributing role for migraine and 1 with an equivocal cardioembolic source; recent illicit drug use (n=4); possible migrainous stroke (n=3), including 2 cases with concurrent oral contraceptive use; atherosclerosis (<=60% stenosis) (n=3); pregnancy-associated stroke (n=2); and oral contraceptive use (n=2).

Case patients were also classified as having large-vessel extracranial disease or intracranial disease (n=36), small-vessel disease (n=6), or indeterminate (n=23), a category that included more than one vessel type, based on both clinical and radiological features.

Control subjects were women without a history of stroke, frequency matched by age and geographic region of residence to the cases, identified by random-digit dialing.

The P1A genotyping for the GpIIIa polymorphism was performed as follows: Genomic DNA was isolated from 0.2 mL frozen whole blood with a QIAmp blood isolation kit (Qiagen)* according to the manufacturer's recommendations and eluted with 200 µL Tris HCl (pH 8.0). Five microliters of purified DNA was used in a polymerase chain reaction containing primers (5' ttctgattgctggacttctctt 3' and 5' tctctccccatggcaaagagt 3') in a final volume of 50 µL to yield a 266 bp DNA product.12 One tenth (5 µL) of the amplified DNA was digested to completion with restriction endonuclease Msp-I (Promega) and electrophoresed in a 10% polyacrylamide gel to generate three genotype-related patterns as described by Weiss et al.7 DNA specimens corresponding to all three genotypes that had been verified by DNA sequencing were included in the laboratory genotyping process as controls. Genotyping was performed by laboratory personnel blinded to the protocol, and each sample was examined two or more times with concordant genotype results. Furthermore, independent confirmation of genotypes was obtained by blinded analysis of a subset of samples in the laboratory of P.G.-C. and P.B. with use of reverse dot blot hybridization and by Msp-I restriction endonuclease, assay as previously described.13 Only four study participants were homozygous for the P1A2 allele (3 case patients and 1 control subject). Because of the small number of homozygotes and because there is evidence that heterozygotes are also associated with increased vascular risk,7 the homozygous and heterozygous groups were combined.

Potential confounders of the association between the P1A2 alleles and stroke included age, race, hypertension, diabetes mellitus, high blood cholesterol, and cigarette smoking. Hypertension and diabetes mellitus were determined by asking study participants (or the proxy, if a participant was unable to answer) if they had ever been told by a physician that they had the condition. Similarly, age, race, and current smoking status were determined by subject or proxy report. Cholesterol was measured according to standard practice,14 with >=200 mg/dL considered a high blood cholesterol level.

t tests were used to compare means and {chi}2 tests to compare proportions. All probability values were two sided. Adjusted ORs derived from logistic regression were used to determine whether the presence of the P1A2 allele was associated with an increased risk for stroke after controlling for differences in age, race, hypertension, diabetes mellitus, high blood cholesterol, and cigarette smoking status.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowSubjects and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Table 1Down compares women with a first cerebral infarction and control subjects with respect to the major known vascular risk factors. Cases and controls were matched for age. Cases were more likely than controls to be black (49.2% versus 37.2%), were significantly more likely to have hypertension and diabetes, and tended to have higher cholesterol levels and higher cigarette smoking rates. The risk-factor profile of persons with stroke due to an identified probable underlying cause was similar to that for all strokes (mean age, 36.5 years; black race, 44.4%; history of high blood pressure, 33.3%; diabetes mellitus, 33.3%; high blood cholesterol level, 50%; former smoker, 16.7%; and current smoker, 55.6%).


View this table:
[in this window]
[in a new window]
 
Table 1. Baseline Characteristics of Study Participants

The case patients were more likely to have traditional vascular disease risk factors than were the controls; if these factors were also associated with the P1A2 allele, these factors could confound the relationship between the P1A2 allele and stroke. Table 2Down examines the association between the risk factors described above and the P1A2 allele among controls, stratified by race. Hypertension was associated with the P1A2 allele among blacks only (P=.015); no other associations achieved statistical significance.


View this table:
[in this window]
[in a new window]
 
Table 2. Prevalence of One or More P1A2 Alleles According to Selected Characteristics

Table 3Down examines the association between genotype and cerebral infarction, overall and stratified by race. Among the cases and controls, the P1A2 polymorphism was slightly more prevalent in whites (36% and 28%, respectively) than in blacks (21% and 22%, respectively). After adjustment for differences in age, race, hypertension, diabetes mellitus, high cholesterol and current smoking status, the presence of at least one P1A2 allele conferred an OR for stroke of 1.1 (95% CI, 0.6 to 2.3). In addition, there was a suggestion that the P1A2 allele is a stronger risk factor for stroke among whites (OR, 1.4) than among blacks (OR, 0.5).


View this table:
[in this window]
[in a new window]
 
Table 3. Presence of One or More A2 Alleles and Risk of Cerebral Infarction

Table 4Down examines the association between genotype and stroke among young women in the subset with an identified probable underlying cause of cerebral infarction (n=18). Compared with the controls, these cases had a substantially higher prevalence of the PIA2 allele (50% versus 25%). The presence of the allele was associated with a threefold increased risk for stroke adjusted for other factors (95% CI, 0.9 to 10.4). This increased risk was exclusively due to the stronger association among white women (adjusted OR, 12.8; 95% CI, 1.2 to 135.0). In contrast to these findings among whites, the P1A2 allele was not associated with an increased risk of stroke among blacks (adjusted OR, 0.7; 95% CI, 0.1 to 7.1).


View this table:
[in this window]
[in a new window]
 
Table 4. Presence of One or More A2 Alleles and Risk for Cerebral Infarction in Cases With an Identified Probable Cause for Stroke

Cases without an identified probable underlying cause of cerebral infarction were also examined in race-stratified analyses and did not show an association between genotype and risk for stroke (data not shown).

Among cases classified as having an intracranial or extracranial large-vessel stroke (n=36), the adjusted ORs were 0.7 (95% CI, 0.2 to 1.8) overall, 1.3 (95% CI, 0.3 to 4.8) for whites, and 0.1 (95% CI, 0.01 to 1.6) for blacks. The limited number of small-vessel strokes (n=6) precluded meaningful analyses in this subgroup. Among cases classified as having an indeterminate or mixed vessel type (n=23), the adjusted ORs were 2.4 (95% CI, 0.9 to 6.5) overall, 3.1 (95% CI, 0.7 to 13.3) for whites, and 1.5 (95% CI, 0.3 to 6.9) for blacks.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowSubjects and Methods
up arrowResults
*Discussion
down arrowReferences
 
This study of stroke in young women did not show a significant association between P1A2 and all cerebral infarctions. Subgroup analyses, performed with a previously published classification system1 indicated more of an effect among stroke cases with an identified probable etiology than among those with no identified probable etiology. P1A2 has been reported to be associated with cardiac disease,7 8 almost exclusively a large-vessel process. However, our data do not support an effect predominantly among large-vessel strokes. Compared with MI, stroke is a more heterogeneous process, with multiple etiologies. We could identify an association between P1A2 and stroke of diverse identified causes, including atherosclerosis, cardiac emboli, nonatherosclerotic vasculopathy, and hematologic conditions. This suggests that the P1A2 allele could interact with other conditions predisposing to stroke, analogous to the effect of the factor V Leiden mutation on the risk of cerebral venous thrombosis.15 Women with a condition strongly predisposing to stroke may be more likely to have a stroke at an earlier age if they have the P1A2 allele than women without the allele.

It is known that the P1A2 allele is less prevalent in black than in white populations (16% versus 20% with one or more alleles),16 but prior studies of the association of P1A2 with thrombotic events have not included blacks. Among black control subjects, we noted an increased prevalence of P1A2 positivity in those with hypertension. However, since our data do not support an association of the P1A2 allele with stroke in young black women, further studies will be needed to clarify the role of P1A2 in stroke and hypertension among blacks.

Prior research on the relation of the P1A2 allele to vascular disease has shown varying results. The original observation by Weiss and coworkers7 from Baltimore among 71 white men with myocardial infarction or unstable angina and 68 inpatient controls showed a P1A2 prevalence of 39.4% among the cases and 19.1% among the controls. The overall association was predominantly due to the effect among the 42 patients under 60 years of age, where this allele had a prevalence of 50% and was 3.6 times more frequent in patients than among controls.7 These observations were supported by a report by Carter et al8 from Leeds, England, where the P1A2 allele was found in 50% of 24 white men with myocardial infarction before age 47 and in 27% of 45 age-matched controls. In contrast, a report based on men in the Physicians' Health Study9 17 failed to show an association between the AlA2 allele and myocardial infarction (n=374), ischemic stroke (n=146), or venous thromboembolism (n=121). No association was evident even when the analysis was limited to patients younger than 60 years of age. Carlsson and coworkers10 found no difference in the prevalence of P1A2 or other human platelet antigen polymorphisms between 218 patients with ischemic stroke or transient ischemic attacks and 165 neurological inpatients without acute or recent signs of cerebrovascular disease and 321 healthy blood donors. The mean age of the patients with cerebral ischemia was 62.1 years; analyses were not stratified by age.

These disparate results can be considered in the context of the several different explanations for an association of a genetic marker with disease.18 First, the marker allele may be a part of the pathological process and define a susceptibility locus. The role of GpIIb-IIIa as a platelet membrane receptor that binds fibrinogen and von Willebrand factor provides a biological rationale for this possibility.5 Second, the marker allele may not cause the trait but may be in linkage disequilibrium with an unobserved "high-risk" allele at a different susceptibility locus. Linkage disequilibrium is a function of the history of the population, and thus true associations due to linkage disequilibrium can occur in one population and not in another. Third, positive associations can also occur as an artifact of population admixture. There may be confounding between unrecognized subgroups of the population, in which both the marker allele frequency and the disease prevalence differ across strata of the population. Confounding may also obscure the presence of a susceptibility locus or linkage to such a locus. This potential problem may be expressed in different ways in different populations. Therefore, the disparate results among studies of the association of the P1A2 allele with disease may be due to linkage disequilibrium, confounding by population admixture, or age differences. Our population-based case-control design with analysis stratified by race was intended to minimize the problem of population admixture.

A limitation of our study is the small sample size, which increases the likelihood of both type 1 and type 2 errors. Because stroke in the young is uncommon, it is difficult to obtain a large population-based patient group for a case-control study. Ours is the only study of the P1A2 allele in a multiracial population of young women. Our results are promising, because the wide confidence intervals do not exclude the possibility of an OR in the range of 2 to 4 for the overall group. Similarly, the strong effect among the subgroup of white women with an identified probable cause, while statistically significant, also had wide confidence intervals and will require replication.

The formation of a platelet clot requires the binding of fibrinogen and von Willebrand factor to its receptor, GpIIb-IIIa, on the platelet surface.5 Antiplatelet therapy has been a mainstay of both primary and secondary stroke prevention. This therapy has included aspirin, which inhibits platelet cyclooxygenase and thromboxane A2 production, and ticlopidine, which inhibits ADP activation of GpIIb-IIIa.19 20 Other antiplatelet agents that selectively inhibit the Gp receptor have been developed.21 P1A2 is a highly prevalent polymorphism in both whites and blacks. Confirmation that this allele affects susceptibility to stroke would raise the prospect of stroke prevention efforts specific to genotype status. Further work in this area with an emphasis on stroke subtypes and with multiracial populations is warranted.


*    Acknowledgments
 
Supported in part by a clinical stroke research center award (NS16332–11) from the National Institute of Neurological Disorders and Stroke. We are indebted to Chad H. Richardson for his outstanding technical assistance and to the following members of the Stroke Prevention in Young Women research team for their dedication: Anne Epstein, James Gardner, Mary Keiser, Ann Maher, Jennifer Rohr, Mary J. Seipp, Susan Snyder, Mary J. Sparks, and Nancy Zappala.

The authors would like to acknowledge the assistance of the following individuals who have sponsored the Stroke Prevention in Young Women Study at their institution: Frank Anderson, MD; Clifford Andrew, MD, PhD; Christopher Bever, MD; Nicholas Buendia, MD; Young Ja Cho, MD; James Christensen, MD; Remzi Demir, MD; Terry Detrich, MD; John Eckholdt, MD; Nirmala Fernback, MD; Jerold Fleishman, MD; Benjamin Frishberg, MD; Stuart Goodman, MD, PhD; Norman Hershkowitz, MD, PhD; Luke Kao, MD, PhD; Mehrullah Khan, MD; Ramesh Khurana, MD; John Kurtzke, MD; William Leahy, MD; William Lightfoote II, MD; Bruce Lobar, MD; Michael Miller, MD, PhD; Harshad Mody, MBBS; Marvin Mordes, MD; Seth Morgan, MD; Howard Moses, MD; Sivarama Nandipati, MD; Mark Ozer, MD; Roger Packer, MD; Thaddeus Pula, MD; Philip Pulaski, MD; Naghbushan Rao, MD; Marc Raphaelson, MD; Solomon Robbins, MD; David Satinsky, MD; Elijah Saunders, MD; Michael Sellman, MD, PhD; Arthur Siebens, MD (deceased); Harold Stevens, MD, PhD; Dean Tippett, MD; Roger Weir, MD; Michael Weinrich, MD; Richard Weisman, MD; Don Wood, MD (deceased); and Mohammed Yaseen, MD.

In addition, the study could not have been completed without the support from the administration and medical records staff at the following institutions. Maryland: Anne Arundel Medical Center, Atlantic General Hospital, Bon Secours Hospital, Calvert Memorial Hospital, Carroll County General, Church Hospital Corporation, Doctors Community Hospital, Fallston General Hospital, Franklin Square Hospital Center, Frederick Memorial Hospital, The Good Samaritan Hospital of Maryland Inc, Greater Baltimore Medical Center, Harbor Hospital Center, Harford Memorial Hospital, Holy Cross Hospital, Johns Hopkins Bayview Inc, The Johns Hopkins Hospital, Howard County General Hospital Inc, Kennedy Krieger Institute, Kent and Queen Anne Hospital, Laurel Regional Hospital, Liberty Medical Center Inc, Maryland General Hospital, McCready Memorial Hospital, Memorial Hospital at Easton, Mercy Medical Center, Montebello Rehabilitation Hospital, Montgomery General Hospital, North Arundel Hospital, Northwest Hospital Center, Peninsula Regional Medical Center, Physician's Memorial Hospital, Prince George's Hospital Center, Saint Agnes Hospital, Saint Joseph Hospital, Saint Mary's Hospital, Shady Grove Adventist Hospital, Sinai Hospital of Baltimore, Southern Maryland Hospital Center, Suburban Hospital, The Union Memorial Hospital, University of Maryland Medical System, Department of Veterans Affairs Medical Center in Baltimore, Washington Adventist Hospital, and Washington County Hospital. Washington, DC: Children's National Medical Center, District of Columbia General Hospital, The George Washington University Medical Center, Georgetown University Hospital, Greater Southeast Community Hospital, Hadley Memorial Hospital, Howard University Hospital, National Rehabilitation Hospital, Providence Hospital, Sibley Memorial Hospital, Veterans Affairs Medical Center, and The Washington Hospital Center. Pennsylvania: Gettysburg Hospital and Hanover General Hospital.

Received November 7, 1997; accepted January 7, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowSubjects and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Johnson CJ, Kittner SJ, McCarter RJ, Sloan MA, Stern BJ, Buchholz D, Price TR. Interrater reliability of an etiologic classification of ischemic stroke. Stroke. 1995;26:46–51.[Abstract/Free Full Text]

2. Khaw K, Barrett-Connor E. Family history of stroke as an independent predictor of ischemic heart disease in men and stroke in women. Am J Epidemiol. 1986;123:59–66.[Abstract/Free Full Text]

3. Welin L, Svardsudd K, Wilhelmsen L, Larsson B, Tibblin G. Analysis of risk factors for stroke in a cohort of men born in 1913. N Engl J Med. 1987;317:521–526.[Abstract]

4. Carrieri PB, Orefice G, Maiorino A, Provitera V, Balzano G, Lucariello A. Age-related risk factors for ischemic stroke in Italian men. Neuroepidemiology. 1994;13:28–33.[Medline] [Order article via Infotrieve]

5. Phillips DR, Charo IF, Parise LV, Fitzgerald LA. The platelet membrane glycoprotein IIb-IIIa complex. Blood. 1988;71:831–843.[Free Full Text]

6. Newman PJ, Derbes RS, Aster RH. The human platelet alloantigens PIA1 and PIA2 are associated with a leucine 33/proline 33 amino acid polymorphism in membrane glycoprotein IIIa and are distinguishable by DNA typing. J Clin Invest. 1989;83:1778–1781.

7. Weiss EJ, Bray PF, Tayback M, Schulman SP, Kickler TS, Becker LC, Weiss JL, Gerstenblith G, Goldschmidt-Clermont PJ. A polymorphism of a platelet glycoprotein receptor as an inherited risk factor for coronary thrombosis. N Engl J Med. 1996;334:1090–1094.[Abstract/Free Full Text]

8. Carter AM, Ossei-Gerning N, Grant PJ. Platelet Glycoprotein IIIa P1A polymorphism in young men with myocardial infarction. Lancet. 1996;348:485–486.[Medline] [Order article via Infotrieve]

9. Ridker PM, Hennekens CH, Schmitz C, Stampfer MJ, Lindpainter K. P1A1/A2 polymorphism of platelet glycoprotein IIIa and risks of myocardial infarction, stroke, and venous thrombosis. Lancet. 1997;349:385–388.[Medline] [Order article via Infotrieve]

10. Carllsson LE, Greinacher A, Spitzer C, Walther R, Kessler C. Polymorphisms of the human platelet antigens HPA-1, HPA-2, HPA-3, and HPA-5 on the platelet receptors for fibrinogen (GPIIb/IIIa), von Willebrand factor (GPIb/IX), and collagen (GPIa/IIa) are not correlated with an increased risk of stroke. Stroke. 1997;28:1392–1395.[Abstract/Free Full Text]

11. Kittner SJ, Stern BJ, Feeser BR, Hebel JR, Nagey DA, Buchholz DW, Early CJ, Johnson CJ, Macko RF, Sloan MA, et al. Pregnancy and the risk of stroke. N Engl J Med. 1996;335:768–774.[Abstract/Free Full Text]

12. Jin Y, Dietz HC, Nurden A, Bray PF. Single-strand conformation polymorphism analysis is a rapid and effective method for identification of mutations and polymorphisms in the gene for glycoprotein IIIa. Blood. 1993;82:2281–2288.[Abstract/Free Full Text]

13. Bray PF, Jin Y, Kichler T. Rapid genotyping of the five major platelet alloantigens by reverse dot-blot hybridization. Blood. 1994;84:4361–4367.[Abstract/Free Full Text]

14. Fundamentals of Clinical Chemistry. Philadelphia, Pa: WB Saunders. 1976.

15. Zuber M, Toulon P, Marnet L, Mas JL. Factor V Leiden mutation in cerebral venous thrombosis. Stroke. 1996;27:1721–1723.[Abstract/Free Full Text]

16. Kim H, Jin Y, Kickler TS, Blakemore K, Kwon OH, Bray PF. Gene frequencies of the five majors human platelet antigens in African-American, white and Korean populations. Transfusion. 1995;35:865–867.

17. Ridker PM. P1A1/A2 polymorphism of platelet glycoprotein IIIa and risk of cardiovascular disease. Lancet. 1997;349:385–388.

18. Lander ES, Shork NJ. Genetic dissection of complex traits. Science. 1994;265:2037–2048.[Abstract/Free Full Text]

19. Fitzgerald GA, Meagher EA. Antiplatelet drugs. Eur J Clin Invest. 1994;24(suppl):46–49.

20. Haynes RB, Sandler RS, Larson EB. A critical appraisal of ticlopidine, a new antiplatelet agent. Effectiveness and clinical indications for prophylaxis of atherosclerotic events. Arch Intern Med. 1992;152:1376–1380.[Abstract/Free Full Text]

21. Lefkovits J, Plow EF, Topol EJ. Platelet glycoprotein Ib/IIIa receptors in cardiovascular medicine. N Engl J Med. 1995;332:1553–1559.[Free Full Text]




This article has been cited by other articles:


Home page
Circ Cardiovasc GenetHome page
S. Debette and S. Seshadri
Genetics of Atherothrombotic and Lacunar Stroke
Circ Cardiovasc Genet, April 1, 2009; 2(2): 191 - 198.
[Full Text] [PDF]


Home page
In VivoHome page
T. CHIRAS, E. D. PAPADAKIS, A. KATOPODI, E. CHATZIANESTI, K. FOURTOUNAS, S. PAPAKONSTANTINOU, I. THEODOROPOULOS, A. DAKOURAS, N. ZEREFOS, D. VALIS, et al.
Platelet GP IIIA Polymorphism HPA-1 (PLA1/2) Is Associated with Hypertension as the Primary Cause for End-stage Renal Disease in Hemodialysis Patients from Greece
In Vivo, January 1, 2009; 23(1): 177 - 181.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
N. K.J. Oksala, M. Heikkinen, J. Mikkelsson, T. Pohjasvaara, M. Kaste, T. Erkinjuntti, and P. J. Karhunen
Smoking and the Platelet Fibrinogen Receptor Glycoprotein IIb/IIIA PlA1/A2 Polymorphism Interact in the Risk of Lacunar Stroke and Midterm Survival
Stroke, January 1, 2007; 38(1): 50 - 55.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
C. D. Bushnell, P. Hurn, C. Colton, V. M. Miller, G. del Zoppo, M. S.V. Elkind, B. Stern, D. Herrington, G. Ford-Lynch, P. Gorelick, et al.
Advancing the Study of Stroke in Women: Summary and Recommendations for Future Research From an NINDS-Sponsored Multidisciplinary Working Group
Stroke, September 1, 2006; 37(9): 2387 - 2399.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
V. Wiwanitkit
PIA1/A2 Polymorphism of the Platelet Glycoprotein Receptor IIb/IIIIa and Its Correlation With Myocardial Infarction: An Appraisal
Clinical and Applied Thrombosis/Hemostasis, January 1, 2006; 12(1): 93 - 95.
[Abstract] [PDF]


Home page
J. Physiol.Home page
L. Anderson
Candidate-based proteomics in the search for biomarkers of cardiovascular disease
J. Physiol., February 15, 2005; 563(1): 23 - 60.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
J. P. Casas, A. D. Hingorani, L. E. Bautista, and P. Sharma
Meta-analysis of Genetic Studies in Ischemic Stroke: Thirty-two Genes Involving Approximately 18 000 Cases and 58 000 Controls
Arch Neurol, November 1, 2004; 61(11): 1652 - 1661.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
K. Gwinn-Hardy and V. Dawson
Genomics-Proteomics and Stroke: Introduction
Stroke, November 1, 2004; 35(11_suppl_1): 2731 - 2734.
[Full Text] [PDF]


Home page
StrokeHome page
A. Slowik, T. Dziedzic, W. Turaj, J. Pera, L. Glodzik-Sobanska, P. Szermer, M. T. Malecki, D. A. Figlewicz, and A. Szczudlik
A2 Alelle of GpIIIa Gene Is a Risk Factor for Stroke Caused by Large-Vessel Disease in Males
Stroke, July 1, 2004; 35(7): 1589 - 1593.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. Voetsch and J. Loscalzo
Genetic Determinants of Arterial Thrombosis
Arterioscler. Thromb. Vasc. Biol., February 1, 2004; 24(2): 216 - 229.
[Abstract] [Full Text]


Home page
NeurologyHome page
S. J. Kittner
Stroke in the young: Coming of age
Neurology, July 9, 2002; 59(1): 6 - 7.
[Full Text] [PDF]


Home page
StrokeHome page
J.Y. Streifler, N. Rosenberg, A. Chetrit, R. Eskaraev, B.A. Sela, R. Dardik, A. Zivelin, B. Ravid, J. Davidson, U. Seligsohn, et al.
Cerebrovascular Events in Patients With Significant Stenosis of the Carotid Artery Are Associated With Hyperhomocysteinemia and Platelet Antigen-1 (Leu33Pro) Polymorphism
Stroke, December 1, 2001; 32(12): 2753 - 2758.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
G.J. Hademenos, M.J. Alberts, I. Awad, M. Mayberg, T. Shephard, A. Jagoda, R.E. Latchaw, H.W. Todd, K. Viste, R. Starke, et al.
Advances in the genetics of cerebrovascular disease and stroke
Neurology, April 24, 2001; 56(8): 997 - 1008.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
T C F Sykes, C Fegan, and D Mosquera
Thrombophilia, polymorphisms, and vascular disease
Mol. Pathol., December 1, 2000; 53(6): 300 - 306.
[Abstract] [Full Text]


Home page
BrainHome page
A. Hassan and H. S. Markus
Genetics and ischaemic stroke
Brain, September 1, 2000; 123(9): 1784 - 1812.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
A. P. Reiner, P. N. Kumar, S. M. Schwartz, W. T. Longstreth Jr, R. M. Pearce, F. R. Rosendaal, B. M. Psaty, and D. S. Siscovick
Genetic Variants of Platelet Glycoprotein Receptors and Risk of Stroke in Young Women
Stroke, July 1, 2000; 31(7): 1628 - 1633.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
A. Sonoda, M. Murata, D. Ito, N. Tanahashi, A. Ohta, Y. Tada, E. Takeshita, T. Yoshida, I. Saito, M. Yamamoto, et al.
Association Between Platelet Glycoprotein Ib{alpha} Genotype and Ischemic Cerebrovascular Disease
Stroke, February 1, 2000; 31(2): 493 - 497.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wagner, K. R.
Right arrow Articles by Kittner, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wagner, K. R.
Right arrow Articles by Kittner, S. J.