(Stroke. 1999;30:1671-1678.)
© 1999 American Heart Association, Inc.
Original Contributions |
Transforming Growth Factor-ß Mediates Astrocyte-Specific Regulation of Brain Endothelial Anticoagulant Factors
From the Department of Neurology, University of Southern California School of Medicine, Los Angeles (N.D.T., J.C., S.S.S., M.F.), and FLENI Institute for Neurological Research, Buenos Aires, Argentina (J.C.).
Correspondence to Mark Fisher, MD, Department of Neurology, University of California, Irvine Medical Center, 101 The City Drive South, Building 3, Room 313, Orange, CA 92868. E-mail mfisher{at}uci.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferencesIntroduction References |
|---|
Background and Purpose—Astrocytes are potent regulators of brain capillary endothelial cell function. Recently, astrocytes were shown to regulate brain capillary endothelial expression of the fibrinolytic enzyme tissue plasminogen activator (tPA) and the anticoagulant thrombomodulin (TM). To study the mechanism of this process, we examined the hypothesis that astrocyte regulation of endothelial tPA and TM is mediated by transforming growth factor-ß (TGF-ß).
Methods—Brain capillary endothelial cells were grown in blood-brain barrier models. We examined astrocyte-endothelial cocultures, endothelial monocultures, and astrocyte-conditioned media (ACM) for the expression of TGF-ß. We also incubated endothelial cells with ACM to determine the role of TGF-ß. Following 24 hours of incubation, we assayed for tPA and TM mRNA, as well as tPA and TM activity.
Results—Astrocyte-endothelial cocultures and ACM exhibited significantly higher levels of active TGF-ß than brain endothelial monocultures and endothelial cells grown in nonconditioned media, respectively. Brain endothelial cells incubated with ACM exhibited reduced tPA and TM mRNA and activity. Treatment with exogenous TGF-ß produced dose-dependent reductions in tPA and TM. The effects of ACM on both tPA and TM were blocked by TGF-ß neutralizing antibody.
Conclusions—These data indicate that TGF-ß mediates astrocyte regulation of brain capillary endothelial expression of tPA and TM.
Key Words: astrocytes • blood-brain barrier • endothelium • thrombomodulin • tissue plasminogen activator • transforming growth factors
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferencesIntroduction References |
|---|
Hemostasis is critically important in the pathogenesis of stroke. Acute stroke therapies and secondary stroke prevention strategies involve manipulation of coagulation pathways. Essential elements of coagulation pathways are endothelial dependent, including secretion of the fibrinolytic factor tissue plasminogen activator (tPA) and expression of the antithrombotic integral membrane protein thrombomodulin (TM).
tPA is a critical circulating fibrinolytic enzyme that proteolytically activates plasminogen to plasmin.1 Intravenous tPA improves neurological outcome in clinical stroke.2 Reduced expression of brain capillary tPA is associated with increased infarct size following transient middle cerebral artery occlusion in diabetic and nicotine stroke models.3 4 Brain capillary endothelial expression of tPA is limited,5 6 7 and understanding mechanisms underlying this limited expression has potential therapeutic value.
TM, an important antithrombotic protein, functions as a cofactor for the activation of circulating protein C.8 9 Both TM and activated protein C offer protection against a variety of thrombotic events. Treatment with purified or recombinant TM protects against thromboembolism in animal models,10 11 12 13 14 while TM neutralizing antibodies potentiate thrombin-induced thromboembolism.10 Treatment with activated protein C also provides protection against thromboembolic events.15 16 Resistance to the effects of activated protein C is closely linked to venous thrombosis in humans,17 including cerebral venous thrombosis.18 Low levels of circulating activated protein C are present in certain forms of ischemic stroke.19 Moreover, brain-specific protein C activation has been demonstrated in humans in vivo20 ; brain capillaries ex vivo also exhibit protein C activation.21 Brain TM expression is limited,22 23 24 25 26 and, like tPA, identification of mechanisms underlying this limited expression would be expected to have therapeutic value.
Astrocytes are regulators for a wide variety of brain capillary
endothelial functions. Astrocytes are responsible for
the induction of the blood-brain barrier (BBB), contributing to tight
junction formation,27 28 increased electric
resistance,29 and expression of highly selective transport
systems delivering essential nutrients to the brain (eg, glucose
transporter 1 [GLUT-1], 
-glutamyl
transpeptidase).28 30 31 32 33 Astrocytes also modulate
endothelial expression of the low-density lipoprotein
receptor34 and Na-K-Cl cotransporter.35
We have recently reported that astrocytes have an important role in the regulation of endothelial expression of critical hemostasis factors. We have demonstrated that astrocytes regulate endothelial expression of both tPA and TM in vitro.36 37 The mechanism of this action has been uncertain. Astrocytes can secrete a number of cytokines and growth factors known to modulate endothelial function, including transforming growth factor-ß (TGF-ß).38 TGF-ß is known to regulate endothelial plasminogen activator activity39 and TM expression.40 We therefore hypothesized that astrocytic regulation of endothelial tPA and TM expression is mediated by TGF-ß.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferencesIntroduction References |
|---|
Cell Culture
We isolated bovine brain capillary endothelial cells by modification of techniques of Carson and Haudenschild,41 as previously described.36 37 Endothelial cells were maintained on gelatin-coated culture dishes in DMEM supplemented with 2.5% equine serum or 5.0% fetal calf serum (FCS). Endothelial cells were characterized by cobblestone-like morphology, uptake of acetylated low-density lipoprotein, and immunoreactivity for von Willebrand factor, as previously described.36 37 Experiments were performed on endothelial cells between passages 10 and 25.
Neonatal mouse astrocytes were isolated according to the methods of McCarthy and deVellis,42 as previously described,36 37 and performed within institutional guidelines. Cells were maintained on DMEM with 10% FCS. Astrocytes were characterized by >99% immunoreactivity for glial fibrillary acidic protein. Astrocytes used for these experiments were taken from primary cultures for establishment of astrocyte-endothelial cocultures. Experiments were performed with the use of primary culture astrocytes between 20 to 40 days postnatal. Mouse liver cells (CCL 9.1, ATCC, Rockville, Md) were maintained under conditions similar to those for astrocytes.
BBB Model
We prepared our BBB model as previously
described.36 37 43 Endothelial cells
elongated and formed capillary-like structures within 24 hours.
Cocultures were established by the addition of astrocytes
(4x104 cells per chamber) or liver cells
(4x104 cells per chamber). After 7 days, nearly
all of the astrocytes were associated with capillary-like structures,
and extensive -glutamyl transpeptidase activity was
present along the length of the capillary-like structures.
Moreover, tight junctions are also present in this
model.43 Thus, astrocyte–endothelial cell
cocultures exhibited morphological and functional features of the
BBB.
Conditioned Media Experiments
We performed conditioned media experiments according to the
method of Maxwell et al.44 Briefly, astrocyte-conditioned
media (ACM) and liver cell–conditioned media were prepared by first
aspirating the growth media from these cultures, washing with PBS, and
replacing media with 5% FCS-supplemented media. Forty-eight hours
later the ACM or liver cell–conditioned media were collected,
centrifuged to remove cellular debris, and stored at -80°C
until use. Bovine brain endothelial cells were plated
in 24-well tissue culture plates (4x104 cells
per well) in 1 mL 5% FCS–supplemented growth media. At confluence the
cells were incubated for 24 hours with media containing 50% ACM (or
liver cell–conditioned media) and 50% fresh growth media or fresh
growth media alone in the presence or absence of neutralizing
anti–TGF-ß monoclonal antibody (20 µg, Genzyme
Diagnostics). Anti–gp-120 monoclonal antibody (obtained
through the AIDS Research and Reference Reagent Program, Division of
AIDS, National Institute of Allergy and Infectious Diseases, National
Institutes of Health, from Dr Bruce Chesebro) was used as a control
irrelevant antibody.
TGF-ß Studies
Bovine brain endothelial cells were plated in
24-well tissue culture plates (4x104 cells per
well) as described above. At confluence, the cells were incubated with
human recombinant TGF-ß1 and TGF-ß2 (Sigma) for 24 hours.
Endothelial cell counts were performed after 24 hours
of TGF-ß incubation. In separate studies, total TGF-ß activity was
determined as a measure of proliferation inhibition with the use of the
mink lung epithelial cell line ATCC CCL-64, as previously
described.45 46 Isoforms of TGF-ß (TGF-ß1 and
TGF-ß2) from conditioned media were measured by enzyme-linked
immunosorbent assay (Promega). TGF-ß concentrations were adjusted to
endothelial cell count.
Polymerase Chain Reaction
Total RNA was isolated with the Glassmax DNA Spin Cartridge
Isolation System (Gibco BRL). cDNA was synthesized from equal
quantities of total RNA, as previously described,36 37 47
and the cDNA was stored at -20°C until use.
Polymerase chain reaction (PCR) primers for bovine tPA (forward primer, BTPA-1: 5'AAGGTTGCAGAAGAAGATGG3' and reverse primer, BTPA-2: 5'GTGAGGCGGGTACCTCTCCTGGAA3') and TM (forward primer, BTM-1: 5'CTCGGCAACTACACGTGCATCTGCGAG3' and reverse primer, BTM-2: 5'GCCACCACCAGAGACAGGCTTGCAATGG3') were chosen from coding regions of the mRNA.48 49 ß-Actin primers (Stratagene; forward primer, 5'TGACGGGGTCACCCACACTGTGCCCATCTA3'; reverse primer, 5'CTAGAAGCATTTGCGGTGGACGATGGAGGG3') were used to amplify ß-actin mRNA as a housekeeping gene control. The PCR mixture contained 0.2 to 1.0 µg cDNA, 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 0.1 mmol/L dNTP, 1.0 mmol/L MgCl2, 1.0 U Taq polymerase, and 0.5 µmol/L forward and reverse primers. Amplification was performed in a Geneamp PCR System 2400 (Perkin-Elmer Corp), as follows: initial denaturation at 94°C; each cycle consists of 30 seconds of denaturation at 94°C; 30 seconds of annealing at 56°C; and 1 minute of extension at 72°C. All reverse transcription–PCR assays were performed within the linear range of the amplification curve. PCR products were visualized by electrophoresis on a 2% agarose gel and stained with ethidium bromide. Negatives were prepared with a Polaroid camera (Polaroid Corp) and scanned by optical densitometry (Hoefer Instruments). Optical densitometric measurements were normalized to ß-actin levels (ie, dividing by ß-actin optical densitometric measurements or by percentage of ß-actin relative to the mean).
Quantitative competitive PCR (QC-PCR) was used to quantify tPA and TM
mRNA expression. QC-PCR analysis has been used extensively for
the quantitation of mRNA36 37 47 50 51 52 ; similar results
are derived from QC-PCR and Northern blot
analysis.51 QC-PCR tubes contained all the
amplification reagents (described above), a constant amount of target
cDNA from each preparation, and serial dilutions of known
concentrations of a competitor tPA or TM cDNA template. Competitor
templates were generated according to the techniques of Tran et
al.36 37 47 After coamplification, the PCR products
were separated by electrophoresis on a 2% agarose gel and visualized
by ethidium bromide staining and UV transillumination (Figure 1
). Negatives were prepared and scanned
by optical densitometry, as described above. Density readings of the
target tPA and TM cDNA were multiplied by 332/479 and 591/707,
respectively, to correct for differences in molecular weight. The ratio
of amplified target versus competitor cDNA optical densities was
plotted as a function of competitor template concentration. The initial
concentration of target cDNA was derived from the point at which the
ratio of target and competitor cDNA optical density equaled 1.
Concentrations of tPA and TM mRNA were adjusted to ß-actin levels, as
described above.
|
Plasminogen Activator Assay
We assayed cultured media from monoculture and coculture
preparations for total plasminogen activator
activity by amidolytic assay (American Diagnostica).
Amiloride (0.5 mmol/L, Sigma) was used to inhibit urokinase
plasminogen activator and allow for the
determination of net tPA activity.53
Protein C Assay
Endothelial TM activity was assayed by measuring
the increase in protein C activation according to the methods of Tsiang
et al.54 Cells were collected with a rubber policeman and
resuspended in a 100-µL solution containing 50 mmol/L Tris-HCl,
2 mmol/L CaCl2, 0.1 mol/L NaCl, 0.1% BSA,
0.1 µg bovine thrombin, 2 µg bovine protein C, pH 8.0. The solution
was incubated at 37°C for 30 minutes. The reaction was terminated by
adding anti–thrombin III (5 µg) and heparin (5 U), and the resulting
mixture was centrifuged at 200g for 5 minutes. Equal
volumes of the reaction mixture and a chromogenic substrate
(S-2366, Kabi) were added to a 96-well microtiter plate. Optical
densities were measured with a spectrophotometer (EL-311SX, BioTek
Instruments) at 405 nm. Endothelial cell lysates were
assayed for protein content by the method of Lowry et
al.55 Endothelial TM activity was
adjusted to protein content.
Statistical Analysis
All data are expressed as mean±SD. Statistical comparisons
between groups were performed with unpaired Student's t
tests and Pearson's correlation coefficients. Differences were
considered significant for P<0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferencesIntroduction References |
|---|
We examined TGF-ß levels in conditioned media in our BBB model. We previously reported downregulation of tPA and TM transcripts in astrocyte-endothelial cocultures in this model.36 37 Astrocyte-endothelial cocultures demonstrated a significant increase in active TGF-ß (3038±323 pg/mL) compared with capillary-like structure monocultures (821±429 pg/mL; P<0.001). We analyzed our data for potential association between active TGF-ß and mRNA levels. There was a significant inverse correlation between active TGF-ß and tPA mRNA (r=-0.73, P<0.04) and TM mRNA concentrations (r=-0.90, P<0.003).
To determine whether TGF-ß can downregulate tPA and TM mRNA, we
incubated brain capillary endothelial cells with human
recombinant TGF-ß1 and TGF-ß2 (the 2 best-characterized isoforms).
Treatment with TGF-ß1 resulted in downregulation of
endothelial tPA and TM mRNA in a dose-dependent manner
(Figure 2). TGF-ß2 treatment also
produced dose-dependent downregulation of tPA and TM mRNA (Figure 2). Cell counts revealed no significant differences between
TGF-ß–incubated and control endothelial cells (data
not shown).
|
We next examined media conditioned by astrocytes for 48 hours (ACM) to
determine whether astrocytes can produce TGF-ß. ACM had significantly
higher levels of active TGF-ß1 (443±71 versus 90±36 pg/mL;
P<0.03) and TGF-ß2 (641±21 versus 86±21 pg/mL;
P<0.002) than nonconditioned growth media. We then
performed experiments using ACM to determine whether the
astrocyte-induced mRNA downregulation is mediated by TGF-ß. Bovine
brain capillary endothelial cells were grown to
confluence and incubated for 24 hours with ACM. Examination of
endothelial transcripts 24 hours after incubation with
ACM revealed reductions in tPA (13.5±5.4 versus 34.3±3.2 pg/mL;
P<0.006) (Figure 3) and TM
mRNA (43.0±2.1 versus 68.8±4.8 pg/mL; P<0.002) (Figure 4) compared with
endothelial cells incubated with nonconditioned media.
Incubation with liver cell–conditioned media (as control) had no
effects on endothelial tPA (32.3±9.9 pg/mL;
P>0.6) or TM transcripts (70.2±3.0 pg/mL;
P>0.7). The downregulation of tPA and TM mRNA was
completely abolished with TGF-ß neutralizing antibody (40.4±1.7 and
69.7±5.5 pg/mL, respectively); the control irrelevant antibody
produced no effect (Figures 3 and 4).
|
|
To examine the functional consequences of mRNA downregulation, we
examined tPA activity in culture media and TM activity from cell
lysates. There was a significant decrease in tPA activity in ACM
incubated compared with control endothelial cells
(15.3±1.8 versus 27.3±1.0 IU/mL; P<0.02). This tPA
downregulation was abolished by TGF-ß neutralizing antibody
(30.9±1.1 IU/mL); control antibody had no effect (17.7±1.3 IU/mL)
(Figure 5). Concurrently, there was a
significant reduction in TM activity in endothelial
cells incubated with ACM compared with control (60±2% versus
100±1%; P<0.02) (Figure 6).
This decrease was not observed in liver cell–conditioned media
incubated cells (95±2% of control; P>0.1). The
downregulation in TM activity was attenuated by TGF-ß neutralizing
antibody (97±4% of control; P>0.5) but not by control
antibody (68±4% of control; P<0.05). These findings
suggest that TGF-ß mediates astrocyte regulation of tPA and TM
expression at the mRNA level.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferencesIntroduction References |
|---|
The present study showed that TGF-ß mediates astrocyte regulation of endothelial expression of anticoagulant factors. We demonstrated a significant increase in active TGF-ß in astrocyte-endothelial cocultures compared with capillary-like structure monocultures. We showed a strong inverse correlation between active TGF-ß concentrations and tPA and TM expression. We also demonstrated that ACM negatively regulates endothelial expression of tPA and TM transcripts. These effects were not demonstrable in endothelial cells incubated with conditioned media from control liver cells, thus indicating astrocyte-specific regulation. These changes in endothelial mRNA expression were blocked by neutralizing antibodies to TGF-ß but not by isotype-matched control antibody. The reductions in endothelial cells transcripts were present with a concomitant reduction in tPA activity and TM activity. These functional changes were also blocked by TGF-ß neutralizing antibodies. Our findings demonstrated that astrocytes specifically regulate 2 critical endothelial anticoagulant factors (tPA and TM) and that this regulation occurs via TGF-ß.
Our data suggest that astrocytes contribute to TGF-ß activation in astrocyte-endothelial cocultures. TGF-ß is synthesized as a large precursor protein consisting of TGF-ß and a latency-associated peptide.56 57 The latency-associated peptide is associated with TGF-ß through noncovalent interactions and prevents TGF-ß from binding to its receptor. TGF-ß can be activated in vitro by a variety of exogenous treatments, including acidification, alkalinization, heat, or protease treatment.58 The cellular mechanisms for TGF-ß activation are not well understood; however, increases in active TGF-ß have also been reported following heterotypic cocultures of endothelial cells with pericytes.59 60 61 We have shown that both latent and active TGF-ß are present in conditioned media from astrocyte monocultures. These data suggest that astrocytes not only secrete TGF-ß but can also regulate its activation.
We found that astrocytes express both TGF-ß1 and TGF-ß2 isoforms. Astrocytes have been reported to express TGF-ß1, TGF-ß2, and TGF-ß3 mRNA but only secrete TGF-ß1 and TGF-ß2 in vitro.38 TGF-ß1 and TGF-ß2 are isoforms found most frequently in the central nervous system.56 TGF-ß can be produced by a number of cells in the central nervous system, including astrocytes and endothelial cells.38 Both astrocyte-derived and endothelial-derived TGF-ß were secreted into the growth media in our coculture preparations. Our assays for TGF-ß cannot assess the relative contributions of TGF-ß by each of these cell types.
Analysis of TGF-ß demonstrated higher concentrations of TGF-ß in media from astrocyte-endothelial cocultures than from ACM. This difference may be attributed to differing culture conditions. (1) Astrocyte-endothelial cocultures represent an angiogenic model in which endothelial cells develop into capillary-like structures; TGF-ß plays an important role in the angiogenic process.62 (2) Coculture media were collected from 7 day astrocyte-endothelial cocultures, whereas ACM were conditioned by astrocytes for only 48 hours. With longer exposure to astrocytes, one would expect to see greater levels of TGF-ß secreted into the culture media. (3) The enhanced expression of TGF-ß in astrocyte-endothelial cocultures may result from autocrine or paracrine regulation.63 TGF-ß secreted by astrocytes and/or endothelial cells may upregulate TGF-ß expression and activation by astrocytes. (4) Finally, astrocyte-endothelial cocultures and endothelial monocultures were grown in 2.5% equine serum, whereas astrocyte and endothelial monolayers were grown in 5.0% fetal calf serum. We cannot exclude the role of serum in the expression of TGF-ß.
TGF-ß has been shown to induce growth inhibition on a number of cell types in vitro, including endothelial cells.57 58 It is possible that tPA and TM downregulation could reflect TGF-ß–induced growth inhibition. However, this explanation is unlikely because our experiments were performed on confluent endothelial cells, and cell counts were similar for TGF-ß–incubated and control endothelial cells.
The extent of tPA downregulation by ACM was comparable to those previously reported by direct astrocyte-endothelial cocultures.37 These findings further corroborate the role of an astrocyte-derived soluble factor, namely TGF-ß, in astrocyte-mediated tPA regulation. In contrast to our tPA findings, the extent of TM downregulation was not as extensive as previously reported in direct astrocyte-endothelial cocultures.36 The differences in TM regulation may reflect differences in our experimental paradigm: (1) In our coculture model, astrocytes were added to subconfluent endothelial cells, whereas ACM were incubated with confluent endothelial monolayers. Proliferating endothelial cells have been reported to be more responsive to astrocytes than confluent endothelial monolayers.32 (2) Astrocytes were cocultured with endothelial cells for 7 days, while endothelial monolayers were exposed to ACM for 24 hours. TGF-ß–mediated TM downregulation may occur in a time-dependent manner. (3) TGF-ß mediates TM downregulation in a dose-dependent manner. In our coculture model, astrocytes are in direct contact with endothelial cells; local concentrations of TGF-ß at this astrocyte-endothelial interface may be significantly higher than TGF-ß concentrations found in coculture media or ACM, eliciting greater biological effects. (4) TM regulation in cocultures may occur through multiple mechanisms; TGF-ß may constitute only 1 component of the astrocyte–endothelial cell interactions. Cellular contact between the 2 cell types may induce further changes in endothelial function. Astrocytic cellular membrane has been reported to modulate selective endothelial function in vitro.33 Moreover, cellular contact in our astrocyte-endothelial cocultures may function as a positive feedback mechanism by enhancing production and/or activation of TGF-ß.
The regulatory roles of astrocytes on endothelial cells through direct cell contact are well defined.28 29 30 31 32 33 35 64 Astrocyte-induced effects can also occur via ACM.27 44 65 66 67 Our findings suggest that astrocyte regulation of endothelial hemostasis function is mediated in part by astrocyte-derived TGF-ß. Astrocytes can elaborate other growth factors (eg, fibroblast growth factor, pleiotrophin, vascular endothelial growth factor) known to affect endothelial function.68 69 70 71 72 Our data cannot exclude the roles of these soluble factors in the regulation of endothelial function. Moreover, we cannot rule out the potential contributions of direct cell contact on regulation of endothelial hemostasis.
Our findings provide further support for the existence of a unique hemostatic regulatory apparatus of the brain. This regulation is astrocyte dependent, occurs in the microcirculation, and is mediated by TGF-ß. While it is important to be cautious in extrapolating our in vitro findings to in vivo phenomena, the negative regulation of tPA and TM suggests a prothrombotic milieu within the brain microvasculature. This prothrombotic milieu may provide evolutionary advantage, protecting the brain from neonatal intracranial hemorrhage. However, with age and development of stroke risk factors, this prothrombotic milieu may become counterproductive and predispose to infarction. Modulation of astrocyte-dependent endothelial hemostasis regulation may lead to new strategies for the treatment and prevention of ischemic stroke.
|
Acknowledgments |
|---|
This study was supported by National Institutes of Health research grant NS-20989.
Received February 2, 1999; revision received March 30, 1999; accepted April 29, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferencesIntroduction References |
|---|
1. Collen D, Lijnen HR. Molecular basis of fibrinolysis, as relevant for thrombolytic therapy. Thromb Haemost. 1995;74:167–171.[Medline] [Order article via Infotrieve]
2.
The National Institute of Neurological Disorders and
Stroke rt-PA Stroke Study Group. Tissue plasminogen
activator for acute ischemic stroke. N
Engl J Med. 1995;333:1581–1587.
3.
Kittaka M, Wang L, Sun N, Schreiber SS, Seeds NW,
Fisher M, Zlokovic BV. Brain capillary tissue plasminogen
activator in a diabetes stroke model. Stroke. 1996;27:712–719.
4. Wang L, Kittaka M, Sun N, Schreiber SS, Zlokovic BV. Chronic nicotine treatment enhances focal ischemic brain injury and depletes free pool of brain microvascular tissue plasminogen activator in rats. J Cereb Blood Flow Metab. 1996;17:136–146.
5. Levin EG, del Zoppo GJ. Localization of tissue plasminogen activator in endothelium of a limited number of vessels. Am J Pathol. 1994;144:855–861.[Abstract]
6.
Shatos MA, Orfeo T, Doherty JM, Penar PL, Collen D,
Mann KG. 
-Thrombin stimulates urokinase production and
DNA synthesis in cultured human cerebral microvascular
endothelial cells. Arterioscler Thromb Vasc
Biol. 1995;15:903–911.
7. Grau GE, de Moerloose P, Bulla O, Lou J, Lei Z, Reber G, Mill N, Ricou B, Morel DR, Suter PM. Haemostatic properties of human pulmonary and cerebral microvascular endothelial cells. Thromb Haemost. 1997;77:585–590.[Medline] [Order article via Infotrieve]
8.
Esmon NL, Owen WG. Identification of an
endothelial cell cofactor for the thrombin-catalyzed
activation of protein C. Proc Natl Acad Sci U S A. 1981;78:2249–2252.
9.
Salem HH, Maruyama I, Ishii H, Majerus PW. Isolation
and characterization of thrombomodulin from human placenta.
J Biol Chem. 1984;259:12246–12251.
10.
Kumada J, Dittman WA, Majerus PW. A role for
thrombomodulin in the pathogenesis of thrombin-induced thromboembolism
in mice. Blood. 1987;71:728–733.
11.
Gomi K, Zushi M, Honda G, Kawahara S, Matsuzaki O,
Kanabayashi T, Yamamato S, Maruyama I, Suzuki K. Antithrombotic effect
of recombinant human thrombomodulin on thrombin-induced thromboembolism
in mice. Blood. 1990;75:1396–1399.
12. Solis MM, Cook C, Cook J, Glaser C, Light D, Morser J, Yu SC, Fink L, Eidt JF. Intravenous recombinant soluble human thrombomodulin prevents venous thrombosis in a rat model. J Vasc Surg. 1991;14:599–604.[Medline] [Order article via Infotrieve]
13. Aoki Y, Takei R, Mohri M, Gonda Y, Gomi K, Sugihara T, Kiyota T, Yamamoto S, Ishida Y, Maruyama I. Antithrombotic effects of recombinant human soluble thrombomodulin (rhs-TM) on arterial venous shunt thrombosis in rats. Am J Hematol. 1994;47:162–166.[Medline] [Order article via Infotrieve]
14. Ono M, Nawa K, Marumoto Y. Antithrombotic effects of recombinant human soluble thrombomodulin in a rat model of vascular shunt thrombosis. Thromb Haemost. 1994;72:421–425.[Medline] [Order article via Infotrieve]
15. Taylor FB, Chang A, Esmon CT, D'Angelo A, Vigano-D'Angelo S, Blick KE. Protein C prevents coagulopathic and lethal effects of Escherichia coli injection in the baboon. J Clin Invest. 1987;79:918–925.
16. Gresele P, Momi S, Berrettini M, Nenci GG, Schwarz HP, Semeraro N, Colucci M. Activated human protein C prevents thrombin-induced thromboembolism in mice: evidence that activated protein C reduces intravascular fibrin accumulation through the inhibition of additional thrombin generation. J Clin Invest. 1998;101:667–676.[Medline] [Order article via Infotrieve]
17.
Svensson PJ, Dahlback B. Resistance to
activated protein C as a basis for venous thrombosis.
N Engl J Med. 1994;330:517–522.
18.
Zuber M, Toulon P, Marnet L, Mas JL. Factor V Leiden
mutation in cerebral venous thrombosis. Stroke. 1996;27:1721–1723.
19.
Macko RF, Ameriso SF, Gruber A, Griffin JH, Fernandez
JA, Barndt R, Quismoro FP, Weiner JM, Fisher M. Impairment of the
protein C system and fibrinolysis in
infection-associated stroke. Stroke. 1996;27:2005–2011.
20.
Macko RF, Killewich LA, Fernandez JA, Cox DK, Gruber A,
Griffin JH. Brain-specific protein C activation during carotid artery
occlusion in humans. Stroke. 1999;30:542–545. Abstract.
21.
Wang L, Tran ND, Kittaka M, Fisher MJ, Schreiber SS,
Zlokovic BV. Thrombomodulin expression in bovine brain capillaries:
anticoagulant function of the blood-brain barrier, regional
differences, and regulatory mechanisms. Arterioscler Thromb Vasc
Biol. 1997;17:3139–3146.
22.
Ishii H, Salem HH, Bell CE, Laporata EA, Majerus PW.
Thrombomodulin, an anticoagulant protein, is absent in the human brain.
Blood. 1986;67:362–365.
23. Wong VLY, Hofman FM, Ishii H, Fisher M. Regional distribution of thrombomodulin in the human brain. Brain Res. 1991;556:1–5.[Medline] [Order article via Infotrieve]
24. Boffa MC, Jackman RW, Peyri N, Boffa JF, George B. Thrombomodulin in the central nervous system. Nouv Rev Fr Hematol. 1991;33:423–429.
25. Isaka T, Yoshimine T, Motokiko M, Kurode R, Ishii H, Hayakawa T. Altered expression of antithrombotic molecules in human glioma vessels. Acta Neuropathol (Berl). 1994;87:81–85.[Medline] [Order article via Infotrieve]
26. Maruno M, Yoshimine T, Isaka T, Kurode R, Ishii H, Mayakawa T. Expression of thrombomodulin in astrocytomas of various malignancy and in gliotic and normal brain. J Neurooncol. 1994;19:155–160.[Medline] [Order article via Infotrieve]
27. Tao-Cheng JH, Nagy Z, Brightman MW. Tight junctions to brain endothelium in vitro are enhanced by astroglia. J Neurosci. 1987;7:3293–3299.[Abstract]
28. Hayashi Y, Nomura M, Yamagishi S, Harada S, Yamashita J, Yamamoto H. Induction of various blood-brain barrier properties in non-neural endothelial cells by close apposition to co-cultured astrocytes. Glia. 1997;19:13–26.[Medline] [Order article via Infotrieve]
29. Dehouck MP, Meresse S, Delorme P, Fruchart JC, Cecchelli R. An easier, reproducible, and mass-production method to study the blood-brain barrier in vitro. J Neurochem. 1990;54:1798–1801.[Medline] [Order article via Infotrieve]
30.
DeBault LE, Cancilla PA. Gamma-glutamyl transpeptidase
in isolated brain endothelial cells: induction by glial
cells in vitro. Science. 1980;207:653–655.
31. Bauer HC, Tontsch U, Amberger A, Bauer H. Gamma-glutamyl-transpeptidase (GGTP) and Na-K-ATPase activities in different subpopulations of cloned cerebral endothelial cells: responses to glial stimulation. Biochem Biophys Res Commun. 1990;168:358–363.[Medline] [Order article via Infotrieve]
32. Meyer J, Rauh J, Galla H. The susceptibility of cerebral endothelial cells to astroglial induction of blood-brain barrier enzymes depends on their proliferative state. J Neurochem. 1991;57:1971–1977.[Medline] [Order article via Infotrieve]
33. Tontsch U, Bauer H. Glial cells and neurons induce blood-brain barrier related enzymes in cultured cerebral endothelial cells. Brain Res. 1991;539:247–253.[Medline] [Order article via Infotrieve]
34.
Dehouck B, Dehouck MP, Fruchart JC, Cecchelli R.
Upregulation of the low density lipoprotein at the blood-brain barrier:
intercommunications between brain capillary endothelial
cells and astrocytes. J Cell Biol. 1994;126:465–473.
35.
Sun D, Lytle C, O'Donnell ME. Astroglial cell-induced
expression of Na-K-Cl cotransporter in brain microvascular
endothelial cells. Am J Physiol. 1995;269:C1506–C1512.
36.
Tran ND, Wong VLY, Bready J, Schreiber SS, Fisher M.
Regulation of brain capillary endothelial
thrombomodulin mRNA expression. Stroke. 1996;27:2304–2311.
37. Tran ND, Schreiber SS, Fisher M. Astrocyte regulation of endothelial tissue plasminogen activator in a blood-brain barrier model. J Cereb Blood Flow Metab. 1998;18:1316–1324.[Medline] [Order article via Infotrieve]
38. Constam DB, Philipp J, Malipiero UV, Dijke P, Schachner M, Fontana A. Differential expression of transforming growth factor-ß1, -ß2, and -ß3 by glioblastoma cells, astrocytes and microglia. J Immunol. 1992;148:1404–1410.[Abstract]
39.
Saksela O, Moscatelli D, Rifkin DB. The opposing
effects of basic fibroblast growth factor and transforming growth
factor beta on the regulation of plasminogen
activator activity in capillary endothelial
cells. J Cell Biol. 1990;105:957–963.
40. Ohji T, Urano H, Shirahata A, Yamagishi M, Higashi K, Gotoh S, Karasaki Y. Transforming growth factor beta1 and beta2 induce down-modulation of thrombomodulin in human umbilical vein endothelial cells. Thromb Haemost. 1995;73:812–818.[Medline] [Order article via Infotrieve]
41. Carson MP, Haudenschild CC. Microvascular endothelium and pericytes: high yield, low passage cultures. In Vitro Cell Dev Biol. 1986;22:344–354.[Medline] [Order article via Infotrieve]
42.
McCarthy KD, DeVellis J. Preparation of separate
astroglial and oligodendroglial cell cultures from rat cerebral tissue.
J Cell Biol. 1980;85:890–902.
43. Minakawa T, Bready J, Berliner J, Fisher M, Cancilla PA. In vitro interactions of astrocytes and pericytes with capillary-like structures of brain microvessel endothelium. Lab Invest. 1991;65:32–40.[Medline] [Order article via Infotrieve]
44.
Maxwell K, Berliner JA, Cancilla PA. Induction of
-glutamyl transpeptidase in cultured cerebral
endothelial cells by a product released by
astrocytes. Brain Res. 1987;410:309–314.[Medline]
[Order article via Infotrieve]
45. Danielpour D, Dart LL, Flanders KC, Roberts AB, Sporn MB. Immunodetection and quantitation of the two forms of transforming growth factor-ß (TGF-ß1 and TGF-ß2) secreted by cells in culture. J Cell Physiol. 1989;138:79–86.[Medline] [Order article via Infotrieve]
46. Correale J, Gilmore W, McMillan M, Li S, McCarthy K, Le T, Weiner LP. Patterns of cytokine secretion by autoreactive proteolipid protein-specific T cell clones during the course of multiple sclerosis. J Immunol. 1995;154:2959–2968.[Abstract]
47. Tran ND, Wang L, Schreiber SS, Zlokovic BV, Fisher M. Measurement of thrombomodulin mRNA expression in brain capillaries by polymerase chain reaction. Thromb Res. 1998;91:191–197.[Medline] [Order article via Infotrieve]
48. Ravn P, Berglund L, Petersen TE, Larsen LB. Cloning and characterization of the bovine plasminogen activator uPA and tPA. Int Dairy J. 1995;5:605–617.
49.
Jackman RW, Beeler DL, DeWaters L, Rosenberg RD.
Characterization of a thrombomodulin cDNA reveals structural similarity
to the low density lipoprotein receptor. Proc Natl Acad Sci
U S A. 1986;83:8834–8838.
50.
Gilliland G, Perrin S, Blanchard K, Bunn F.
Analysis of cytokine mRNA and DNA: detection and
quantitation by competitive polymerase chain reaction. Proc Natl
Acad Sci U S A. 1990;87:2725–2729.
51. Boado RJ, Pardridge WM. Measurement of blood-brain barrier GLUT-1 glucose transporter and actin mRNA by a quantitative polymerase chain reaction assay. J Neurochem. 1994;62:2085–2090.[Medline] [Order article via Infotrieve]
52. Freeman WM, Walker SJ, Vrana KE. Quantitative RT-PCR: pitfalls and potential. Biotechniques. 1999;26:112–125.[Medline] [Order article via Infotrieve]
53. Vassalli JD, Belin D. Amiloride selectively inhibits the urokinase-type plasminogen activator. FEBS Lett. 1987;214:187–191.[Medline] [Order article via Infotrieve]
54. Tsiang M, Lentz SR, Dittman WA, Wen D, Scaarpati EM, Sadler JE. Equilibrium binding of thrombin to recombinant human thrombomodulin: effect of hirudin, fibrinogen, factor Va, and peptide analogues. Biochemistry. 1990;29:10602–10612.[Medline] [Order article via Infotrieve]
55.
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein
measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265–275.
56. Rifkin DB, Kojima S, Abe M, Harpel JG. TGF-ß: structure, function, and formation. Thromb Haemost. 1993;70:177–179.[Medline] [Order article via Infotrieve]
57. Attisano L, Wrana JL, Lopez-Cassila F, Massague J. TGF-ß receptors and actions. Biochim Biophys Acta. 1994;1222:71–80.[Medline] [Order article via Infotrieve]
58. Miyazono K, Ichijo H., Heldin CH. Transforming growth factor-beta: latent forms, binding proteins and receptors. Growth Factors. 1993;8:11–22.[Medline] [Order article via Infotrieve]
59.
Antonelli-Orlidge A, Saunders KB, Smith SR, D'Amore
PA. An activated form of transforming growth factor-ß is
produced by cocultures of endothelial cells and
pericytes. Proc Natl Acad Sci U S A. 1989;86:4544–4558.
60.
Sato Y, Rifkin DB. Inhibition of
endothelial cell movement by pericytes and smooth
muscle cells: activation of a latent transforming growth factor-beta
1-like molecule by plasmin during co-cultures. J Cell
Biol. 1989;109:309–315.
61.
Sato Y, Tsuboi R, Lyons RM, Moses H, Rifkin DB.
Characterization of the activation of latent TGF-beta by co-cultures of
endothelial cells and pericytes in smooth muscle cells:
a self regulating system. J Cell Biol. 1990;111:757–763.
62. Roberts AB, Sporn MB, Assoian RK, Smith JM, Roche NS, Wakefield LM, Heine UI, Liotta LA, Falange V, Kehrl JH. Transforming growth factor type ß: rapid induction of fibrosis and angiogenesis in vivo and stimulation of collage formation in vitro. Proc Natl Acad Sci U S A. 1986;4167–4171.
63. Morganti-Kossmann MC, Kossmann T, Brandes ME, Mergenhagen SE, Wahl SM. Autocrine and paracrine regulation of astrocyte function by transforming growth factor-ß. J Neuroimmunol. 1992;39:163–173.[Medline] [Order article via Infotrieve]
64. Tio S, Deenen M, Marani E. Astrocyte-mediated induction of alkaline phosphatase activity in human umbilical cord vein endothelium. Eur J Morphol. 1990;28:289–300.[Medline] [Order article via Infotrieve]
65.
Rubin LL, Hall DE, Porter S, Barbu K, Cannon C, Horner
HC, Janatpour M, Liaw CW, Manning K, Morales J, Tanner LI, Tomaselli
KJ, Bard F. A cell culture of the blood-brain barrier. J
Cell Biol. 1991;115:1725–1735.
66. Raub TJ, Kuentzel SL, Sawada GA. Permeability of bovine brain microvessels endothelial cells in vitro: barrier tightening by a factor released from astroglioma cells. Exp Cell Res. 1992;199:330–340.[Medline] [Order article via Infotrieve]
67.
O'Donnell ME, Martinez A, Sun D. Cerebral
microvascular endothelial cell Na-K-Cl cotransport:
regulation by astrocyte-conditioned media. Am J
Physiol. 1995;268:C747–C754.
68. Vandrewinden JM, Mailleux P, Schiffmann SN, Vanderhaeghen JJ. Cellular distribution of the new growth factor pleiotrophin (HB-GAM) mRNA in developing and adult rat tissues. Anat Embryol. 1992;186:387–406.[Medline] [Order article via Infotrieve]
69. Wanaka A, Carroll SL, Milbrandt J. Developmentally regulated expression of pleiotrophin, a novel heparin binding growth factor, in the nervous system of the rat. Brain Res. 1993;72:133–144.
70. Ballabriga J, Pozas E, Planas AM, Ferrer I. BFGF and FGFR-3 immunoreactivity in the rat brain following systemic kainic acid administration at convulsant doses: localization of bFGF and FGFR-3 in reactive astrocytes, and FGFR-3 in reactive microglia. Brain Res. 1997;752:315–318.[Medline] [Order article via Infotrieve]
71.
Moffett J, Kratz E, Myers J, Stachowiak EK, Florkiewicz
RZ, Stachowiak MK. Transcriptional regulation of fibroblast growth
factor-2 expression in human astrocytes: implications for cell
plasticity. Mol Biol Cell. 1998;9:2269–2285.
72. Krum JM, Rosenstein JM. VEGF mRNA and its receptor flt-1 are expressed in reactive astrocytes following neural grafting and tumor cell implantation in the adult CNS. Exp Neurol. 1998;154:57–65.[Medline] [Order article via Infotrieve]
Editorial Comment
Departments of Neurosurgery and Neurology and Neurological Sciences, Stanford University, Palo Alto, California
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferencesIntroduction References |
|---|
Endogenous endothelial anticoagulant factors, including tPA and TM, are known to be neuroprotective against a variety of thrombotic events that occur in acute stroke.1 2 The expression of these endogenous anticoagulant proteins in the brain is rather limited and is known to be tightly regulated. The identification of the mechanisms of the regulation of the expression of these factors is of therapeutic significance.
Using several well-established in vitro culture systems involving primary astrocytes and endothelial cells, concomitant with up-to-date molecular techniques, Tran and colleagues have presented strong evidence demonstrating that TGF-ß, produced by astrocytes, appears to be the culprit responsible for the downregulation of the endothelial tPA and TM mRNA levels. The study is carefully done, the results are convincing, and the findings are novel. The following issues have evolved from this study: (1) The mechanisms causing the activation of astrocytic release of TGF-ß during acute stroke and the subsequent regulation of TGF-ß on tPA and TM transcription are unknown at present. The current findings do provide an impetus for further studies in this area. (2) The astrocytic response to cerebral ischemia is very complex and can be neuroprotective despite the production of TGF-ß. In addition to being a major cellular component forming the intact BBB with endothelial cells, astrocytes are known to provide the necessary microenvironment for neurons to survive under pathological conditions such as ischemia, oxidative injury, and glutamate toxicity.3 4 Thus, future molecular or pharmacological approaches can be directed to amplify the good side (ie, neuroprotection) and to minimize the bad side (ie, production of TGF-ß) of the astrocytic response in acute stroke therapy.
Received February 2, 1999; revision received March 30, 1999; accepted April 29, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferencesIntroduction References |
|---|
1. The National Institute of Neurological Disorders and Stroke rt-PA Stroke Study Group. Tissue plasminogen activator for acute ischemic stroke. N Engl J Med. 1995;333:1581–1587.
2. Kumada T, Dittman WA, Majerus PW. A role for thrombomodulin in the pathogenesis of thrombin-induced thromboembolism in mice. Blood. 1988;71:728–733.
3. Swanson RA, Farrell K, Simon RP. Acidosis causes failure of astrocyte glutamate uptake during hypoxia. J Cereb Blood Flow Metab. 1995;15:417–424.[Medline] [Order article via Infotrieve]
4. Rosenberg PA, Amin S, Leitner M. Glutamate uptake disguises neurotoxic potency of glutamate agonists in cerebral cortex in dissociated cell culture. J Neurosci. 1992;12:56–61.[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  C. E. Hafer-Macko, F. M. Ivey, J. D. Sorkin, and R. F. Macko Microvascular tissue plasminogen activator is reduced in diabetic neuropathy Neurology, July 17, 2007; 69(3): 268 - 274. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-J. Min, M.-s. Yang, S.-U. Kim, I. Jou, and E.-h. Joe Astrocytes Induce Hemeoxygenase-1 Expression in Microglia: A Feasible Mechanism for Preventing Excessive Brain Inflammation J. Neurosci., February 8, 2006; 26(6): 1880 - 1887. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Cucullo, N. Marchi, M. Marroni, V. Fazio, S. Namura, and D. Janigro Blood-Brain Barrier Damage Induces Release of {alpha}2-Macroglobulin Mol. Cell. Proteomics, April 1, 2003; 2(4): 234 - 241. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Sandusky, D. T. Berg, M. A. Richardson, L. Myers, and B. W. Grinnell Modulation of Thrombomodulin-dependent Activation of Human Protein C through Differential Expression of Endothelial Smads J. Biol. Chem., December 13, 2002; 277(51): 49815 - 49819. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-M. Olivot, E. Estebanell, M. Lafay, B. Brohard, M. Aiach, and F. Rendu Thrombomodulin Prolongs Thrombin-Induced Extracellular Signal-Regulated Kinase Phosphorylation and Nuclear Retention in Endothelial Cells Circ. Res., April 13, 2001; 88(7): 681 - 687. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||