(Stroke. 2000;31:40.)
© 2000 American Heart Association, Inc.
Original Contributions |
From the University Departments of Surgery (I.M.L., A.R.N., S.G., M.C., P.R.F.B., M.M.T.) and Pathology (L.J.), Leicester Royal Infirmary, Leicester, UK.
| Abstract |
|---|
|
|
|---|
MethodsPlaques were obtained from 75 consecutive patients undergoing carotid endarterectomy and divided into 4 groups according to symptomatology (group 1, asymptomatic; group 2, symptomatic >6 months before surgery; group 3, symptomatic within 1 to 6 months; group 4, symptomatic within 1 month). All patients underwent preoperative and intraoperative transcranial Doppler monitoring. Plaques were subjected to histological examination and quantification of MMPs by zymography and ELISA.
ResultsThe level of MMP-9 was significantly higher in group 4 (median 125.7 ng/mL for group 4, median <32 ng/mL for all other groups; P=0.003), with no difference in the levels of MMPs 1, 2, or 3. Furthermore, the MMP-9 concentration was significantly higher in plaques undergoing spontaneous embolization (P=0.019) and those with histological evidence of plaque instability (P<0.03). In situ hybridization demonstrated increased MMP-9 expression in highly symptomatic plaques in areas of intense inflammatory infiltrate.
ConclusionsThe concentration, production, and expression of MMP-9 is significantly higher in unstable carotid plaques. If this proves to be a causal relationship, MMP-9 may be a strong candidate for pharmacotherapy aimed at stabilizing plaques and preventing stroke.
Key Words: atherosclerosis metalloproteinases carotid arteries cardiovascular diseases
| Introduction |
|---|
|
|
|---|
| Subjects and Methods |
|---|
|
|
|---|
Preoperative Imaging and Emboli Detected
All patients underwent a preoperative Duplex ultrasound
assessment of the carotid plaque for quantification of the degree of
stenosis. All had >70% stenosis, with no difference
between the groups in the percentage stenosis (Kruskal-Wallis
test, P>0.05). Patients were monitored with
transcranial Doppler (TCD) preoperatively for 30
minutes, as well as intraoperatively during the dissection phase of the
operation. This aimed to identify those with ongoing particulate
microembolization, which is highly indicative of plaque
instability.1 Continuous TCD monitoring of the
ipsilateral middle cerebral artery was performed with a SciMed PC Dop
842 TCD. Signals were recorded on digital audiotape for
offline analysis and interpretation of embolic signals as
described previously.2 For the purpose of the present
study, emboli were only recorded if they occurred in the
preoperative period or the dissection phase of the operation, and after
the internal carotid artery was clamped, recording was
discontinued.
Procurement of Tissue Specimens
Carotid plaques were obtained immediately after
endarterectomy. All operations were performed with
standard surgical techniques and with minimal manipulation of the
specimen. The endarterectomy was extended in a
caudal direction to include a sample of nondiseased common carotid
artery proximal to the plaque but in continuity with the plaque, to act
as a negative paired control. This did not involve a significant change
to the standard operative technique. The plaque and control tissue were
divided longitudinally through the most apparent lesion or the area of
tightest stenosis. These were then processed for quantification
of the major subtypes of MMP and tissue inhibitor of MMP
(TIMP), as well as for histological analysis.
Plasma Samples
Blood was taken from each patient 24 hours before surgery for
the measurement of plasma MMP levels by ELISA.
MMP Quantification
MMP and TIMP levels were quantified by zymography, which, while
semiquantitative, differentiates between active and latent enzyme
forms, as well as by quantitative ELISA. The tissue was snap-frozen in
liquid nitrogen and stored at -70°C until extraction by the method
of Vine and Powell as previously described.3 Briefly,
tissue was weighed, then homogenized in buffer containing
phenylmethylsulfonyl fluoride (0.1 mmol/L; Sigma). After
centrifugation, the supernatant was dialysed for 18
hours at 4°C. The protein concentration was standardized for each
sample to 0.9 mg/mL with PBS, which was found in preliminary
experiments to be within the linear range for densitometric
quantification (data not shown).
Proteins with gelatinolytic activity were identified by use of substrate gels prepared by incorporation of gelatin (1 mg/mL; Sigma) into a 10% SDS-polyacrylamide gel, as previously described.4 The molecular weight of each band was estimated by comparison with the positions of known molecular-weight standards (Bio-Rad). The relative density of each lytic band was determined from negative photographic images of gels with a Pharmacia LKB Imagemaster scanning densitometer. The product of the optical density and area of the band was compared directly with a standardized positive control (media conditioned by HT-1080 human fibrosarcoma cells) to obtain a ratio comparable between gels, as previously described.5 The identities of the lytic zones on the gelatin zymograms were confirmed as MMP-2 and MMP-9 (72 and 92 kDa, respectively) by immunoblotting.
Further quantification was performed by ELISA techniques for MMP-1, MMP-2, MMP-3, MMP-9, TIMP-1, TIMP-2, and TIMP-1/MMP-1 complex with Biotrak assay systems (Amersham), which have been validated for use with human tissue homogenates.6 The TIMP-1/MMP-1 complex assay recognizes activated MMP-1 that has subsequently been complexed with TIMP-1. It does not recognize free MMP-1 or TIMP-1.
Histology
Immediately after removal, the section of plaque for
histological analysis was placed in fresh 4%
paraformaldehyde solution. After overnight
decalcification, the samples were paraffin embedded and sectioned at
4-µm intervals. These were stained with hematoxylin and eosin,
elastic Van Gieson, and monoclonal antibodies for MMP-9 (R&D Systems).
Sections were then evaluated by an experienced histopathologist (L.J.)
who was blinded to the clinical findings and identity of each patient.
Four sections from each plaque were examined for the presence of plaque
rupture, plaque cap thinning, intraplaque hemorrhage,
intraplaque fibrosis, core necrosis, and cap foam cells and graded for
the degree of staining for MMP-9. Plaques were also classified as
necrotic, fibrous, or calcific on the basis of the predominant
component of the plaque, as previously described by Carr et
al.7
mRNA Detection
Reverse-transcription polymerase chain reaction (RT-PCR) was
performed to confirm the expression of MMP-9. Total RNA was extracted
from intact carotid tissue by use of Trizol reagent (Life Technologies)
according to the manufacturers protocol. Reverse transcription was
performed with AMV-RT enzyme and oligo-dT6
primers (Promega) as directed in the enzyme literature. Amplification
of specific sequences was performed by standard PCR methodology, and
primers were designed according to sequences obtained from the GenBank
database (sense 5'-AAGGATCCGACTA-TGACACCGACCGTCG, antisense
5'-AAGAATTCGGCGCCGG-TAGGGCTGGTA). All reaction products were
analyzed on a 1% agarose gel, stained with ethidium bromide,
and photographed under 254-nm ultraviolet illumination.
A well-established, nonisotopic RNA in situ hybridization technique was performed with digoxigenin-labeled oligonucleotide probes based on published sequences. The oligonucleotide sequences for probe synthesis were as follows: ACTGGCAGGGTTTCCCATCAGCATTGCCGT, TCCGGCACTGAGGAATGATCTAAGCCCAGC, GTTGCAGGCATCGTCCACCGGACTCAAAGG, GCTCCCCCTGCCCTCAGAGAATCGCCAGTA, and GCGGCTCCTCAAAGACCGAGTCCAGCTTGC. Sections were deparaffinized, rinsed in 2x SCC, and incubated with 100 µL of proteinase K (2 µL/mL) for 60 minutes at 37°C. After they were washed, the slide samples were prehybridized with 50 µL of prehybridization solution and incubated for 1 hour at 37°C. Digoxigenin-11-dUTPlabeled probes were added to each prehybridized slide in 50 µL of fresh prehybridization solution and left at 37°C overnight. The slides were then washed in 2x SSC/30% formamide twice, after which they were incubated in filtered blocking solution for 10 minutes. Tissue sections were then incubated in antidigoxigenin alkaline phosphatase, washed twice in TBS, then incubated in substrate buffer for 5 minutes. Subsequently, each slide was incubated in the dark in 200 µL of substrate containing 8 µL/mL nitro blue tetrazolium, 8 µL/mL BCIP, and 1 µL/mL levamisole. Slides were checked microscopically until maximum signal occurred before background developed, then they were washed and mounted in aqueous mountant.
Statistical Analysis
All results are expressed as median values and interquartile
ranges. Risk factors and individual histological
features were analyzed by the
2 test,
and densitometry and ELISA results were compared by the Kruskal-Wallis
ANOVA test. Differences in MMP levels between
histological features and emboli detection were
analyzed by the nonpaired, nonparametric
Mann-Whitney U test. Significance was assumed with a
P value <0.05.
| Results |
|---|
|
|
|---|
2 test, P>0.05) (Table 1
|
Histological Examination
The microscopic appearance of the plaques was qualified in all
cases, and the results are shown in Table 2
. Only 2 microscopic features were found
to be significantly more common in the most recently
symptomatic plaques, namely, plaque rupture and intraplaque
hemorrhage.
|
Substrate Gel Zymography
Gelatin zymography and subsequent immunoblotting
revealed the presence of MMP-2 and MMP-9 in both active and inactive
forms (Figure 1
). The amount of active
and inactive MMP-9, as quantified by densitometric analysis,
was significantly higher in the most recently symptomatic
group than in the other 3 groups of patients (Figures 1
and 2
) (P=0.001 for both,
Kruskal-Wallis). There were no significant differences between the
levels of active or latent MMP-2.
|
|
Enzyme-Linked Immunoabsorbent Assay
The median value for the absolute concentration of MMP-9 as
determined by ELISA was 4 times higher in those plaques from symptom
group 4 than from the other 3 groups (Figure 3
), and this was highly significant on
statistical analysis (P=0.003). There were no
differences in the plaque levels of MMP-1, MMP-2, MMP-3, and
MMP-1/TIMP-1 complex between the symptom groups or compared with
control tissue. No significant difference was detected in the levels of
TIMP-1 or TIMP-2 (Table 3
), although the
level of MMP-9 and TIMP-1 was higher in all plaque groups compared with
the corresponding control tissue. For all subtypes, there were no
differences in plasma or control-tissue enzyme levels between the
symptom groups.
|
|
Cerebral Embolization
TCD monitoring detected spontaneous particulate embolization in 21
patients (Table 2
). There was a significant increase in the rate
of embolization in the most recently symptomatic group
compared with the other 3 groups (P<0.01). There were no
strokes.
The level of MMP-9 was significantly higher in those plaques from patients in whom spontaneous embolization was detected (median 31.5 ng/mL for those without embolization versus 72 ng/mL for those with; P=0.017). There was no significant difference in the levels of the other MMP subtypes or in the levels of TIMPs 1 or 2.
Histological Examination and MMP-9 Levels
There was a significantly higher concentration of MMP-9 in those
plaques with histological evidence of instability, in
particular intraplaque hemorrhage, plaque necrosis, and plaque
rupture (Figure 4
). There was no
association between the other MMP subtypes or TIMPs and any of the
histological features studied.
|
Immunocytochemistry, RT-PCR, and In Situ Hybridization
Immunostaining for MMP-9 confirmed the presence of
the enzyme within the plaque, revealing intense staining around the
plaque core, especially in the plaque shoulder and cap (Figure 5a
). This corresponded to areas of
intense inflammatory infiltration, predominantly
macrophages.
|
In situ hybridization for MMP-9 mRNA revealed a similar pattern of
staining in the cap and shoulder of the plaque (Figure 5b
),
confirming MMP-9 production in the plaque. Furthermore, RT-PCR
demonstrated the presence of mRNA for MMP-9 in carotid
homogenates (Figure 6
).
|
| Discussion |
|---|
|
|
|---|
Although proteolytic enzymes have been identified in plaques, no previous study has accurately quantified the levels of the major subtypes within human plaques. In this study, we hypothesized that a localized increase in the level of MMPs may be associated with plaque instability and the onset of clinical events. The aim of the study was to establish the level of the major MMP/TIMP subtypes within carotid plaques and correlate them with clinical and histological features of plaque instability.
The present study has clearly shown that there is a localized increase in the concentration of MMP-9 in the most unstable carotid plaques based on recent focal cerebral ischemic events and has demonstrated expression of MMP-9 within this tissue. Plaques with other features highly indicative of instability, namely, histological evidence of plaque rupture and intraplaque hemorrhage and the detection of spontaneous cerebral particulate embolization, also demonstrated a significant increase in the level of MMP-9 compared with plaques from less symptomatic patients. There were, however, no significant differences in the level of TIMP-1, its major physiological inhibitor. Our data demonstrated no differences in the levels of MMP-1, MMP-2 (both active and latent), and MMP-3. These results suggest that MMP-9 may play a key role in acute plaque disruption leading to the onset of symptoms. Recent work in patients with acute coronary syndromes supports this theory, showing a sharp but transient increase in plasma levels of MMP-9.12 We found no difference in plasma MMP levels, although this may well be related to the broader cohort of patients within each group.
Previous studies have identified the presence of several MMPs within atherosclerotic plaques. Henney et al13 demonstrated the presence of mRNA for MMP-3 in coronary plaques by in situ hybridization, whereas the expression of MMP-1 in carotid plaques was described by Nikkari.14 Galis and colleagues15 described localized increases in MMP-9 surrounding the lipid core of plaques, particularly in the shoulder and cap of the plaque, and demonstrated the presence of both latent and active forms of the enzyme by zymography. However, in all of these studies, the enzyme levels were not quantified, although the latter study reported an increase in overall proteolytic activity in the vulnerable regions of the plaque by in situ zymography. Additionally, in previous studies, the procurement of specimens was not standardized, and the MMP activity could not be related to patient symptomatology. Brown et al16 attempted to associate MMP-9 with plaque instability, documenting intracellular localization of the enzyme in all patients with unstable angina, indicating active synthesis, compared with only 30% of those with stable angina.
Further work is required to establish the precise cause of this localized increase in the level of MMP-9. Inflammation seems to play a key role in destabilization, although alternative factors such as genetic variation, infectious agents, and others require clarification.
Previous studies have shown that the site of plaque rupture is characterized by an intense inflammatory infiltration,17 which consists predominantly of macrophages, foam cells, and T lymphocytes, and it has been hypothesized that this inflammatory infiltration plays a key role in the destabilization of the plaque.18 It appears that this infiltrate within the plaque undergoes a period of activation at the time of acute coronary syndromes, and the associated release of proteolytic enzymes may lead to destabilization of the plaque.19 20 However, the events leading up to this activation remain unclear. Macrophages are certainly potent producers of MMP-9.21 Furthermore, increased expression of MMP-1 and MMP-3 has been reported within carotid plaques in association with macrophage13 14 22 23 and mast cell infiltration,24 whereas active synthesis of MMP-2 has been demonstrated within aortic plaques.25
A genetic variation in the MMP-3 promoter has been associated with the progression of coronary atherosclerosis,26 and it is possible that such genetic variation affects other members of the MMP family. There may also be a role for other factors in the cascade of MMP regulation, such as the plasminogen system,27 oxidized LDL,28 and Chlamydia pneumoniae,29 each of which is undergoing further investigation.
A potential criticism of this study is the grouping of patients by symptom-free duration. This was justified by the significant increase in cerebral emboli detected in group 4. A number of studies have highlighted the importance of spontaneous cerebral embolization in determining the most unstable plaques,1 30 and in the present study, >50% of the recently symptomatic patients had evidence of such emboli. Also, the incidences of plaque rupture and hemorrhage were greater in plaques from patients in group 4. However, both features were identified in patients from each of the symptom groups. Previous studies have identified coronary plaque disruption at postmortem examination in patients who died of noncardiac causes,31 and thus it seems probable that such acute changes can occur in the carotid vessels without causing symptoms. Conversely, histological features of instability were not detected in some patients in the most recently symptomatic group. One limitation of the present study was that by necessity, only a small proportion of each plaque was examined microscopically, and it may well be that features were missed in some patients. This may particularly apply to the identification of cap foam cells, which have been shown in previous studies to be more common in symptomatic plaques and which may be missed when a small number of individual sections is examined.
Again, limited plaque tissue restricted the study in terms of MMP expression. Although we have shown production of the enzyme in the plaque, this requires further quantification by ELISA RT-PCR and Northern blotting.
In summary, although many of the factors that predispose to the early development of the atherosclerotic lesion have been identified, there remains uncertainty as to the reasons why, after years of indolent growth, a plaque should suddenly undergo the acute changes that predispose to the onset of symptoms. This study has identified significantly higher levels of active and latent MMP-9 in the most unstable carotid plaques, as determined by patient symptomatology, spontaneous particulate cerebral embolization, and histological features of instability. Such a localized increase has the potential to cause the acute plaque disruption that precedes the onset of symptoms in both the coronary and cerebral circulations. MMP-9 represents an attractive target for pharmacotherapy to prevent plaque destabilization, and a variety of pharmaceutical agents have been shown to inhibit MMP activity. We recognize that a causal relationship could only be concluded from a formal randomized, controlled trial of an MMP inhibitor in patients with significant stenoses.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received July 9, 1999; revision received October 5, 1999; accepted October 8, 1999.
| References |
|---|
|
|
|---|
2.
Smith JL, Evans D, Fan L, Gaunt ME, Martin PJ,
Bell PRF, Naylor AR. Interpretation of embolic phenomenon during
carotid endarterectomy. Stroke. 1995;26:22812284.
3. Vine N, Powell JT. Metalloproteinases in degenerative aortic disease. Clin Sci. 1991;81:233239.[Medline] [Order article via Infotrieve]
4. Porter K, Loftus IM, Peterson M, Bell PRF, London NJM, Thompson MM. Marimastat inhibits neointimal thickening in a model of human vein graft stenosis. Br J Surg. 1998;85:13731377.[Medline] [Order article via Infotrieve]
5. Zucker S, Mancuso P, DiMassimo B, Lysik RM, Conner C, Wu CL. Comparison of techniques for measurement of gelatinases/type IV collagenases: enzyme linked immunoassays versus substrate degradation assays. Clin Exp Metastasis. 1994;12:1323.[Medline] [Order article via Infotrieve]
6. Fujimoto N, Mouri N, Iwata K, Ohuchi E, Okada Y, Hayakawa T. A one-step sandwich enzyme immunoassay for human matrix metalloproteinase 2 (72-kDa gelatinase/type IV collagenase) using monoclonal antibodies. Clin Chim Acta. 1993;221:91103.[Medline] [Order article via Infotrieve]
7. Carr S, Farb A, Pearce WH, Virmani R, Yao ST. Atherosclerotic plaque rupture in symptomatic carotid artery stenosis. J Vasc Surg. 1996;23:755765.[Medline] [Order article via Infotrieve]
8.
Falk E, Shah P, Fuster V. Coronary
plaque disruption. Circulation. 1995;92:657671.
9.
Dollery CM, McEwan JR, Henney AM. Matrix
metalloproteinases and cardiovascular disease.
Circ Res. 1995;77:863868.
10. Thompson RW, Holmes DR, Mertens RA, Liao S, Botney MD, Mecham RP, Welgus HG, Parks WC. Production and localisation of 92-kD gelatinase in abdominal aortic aneurysms. J Clin Invest. 1995;96:318326.
11. Denis LJ, Verweij J. Matrix metalloproteinase inhibitors: present achievements and future prospects. Invest New Drugs. 1997;15:175185.[Medline] [Order article via Infotrieve]
12.
Kai H, Ikeda H, Yasukawa H, Kai M, Seki Y,
Kuwahara F, Ueno T, Sugi K, Imaizumi T. Peripheral blood
levels of matrix metalloproteinases-2 and -9 are elevated in patients
with acute coronary syndromes. J Am Coll
Cardiol. 1998;32:368372.
13.
Henney AM, Wakeley PR, Davies MJ, Foster K,
Hembrey R, Murphy G, Humphries S. Localization of stromelysin gene
expression in atherosclerotic plaques by in situ hybridization.
Proc Natl Acad Sci U S A. 1991;88:81548158.
14.
Nikkari ST, OBrien KD, Ferguson M, Hatsukami T,
Welgus HG, Alpers CE, Clowes AW. Interstitial
collagenase (MMP-1) expression in human carotid
atherosclerosis. Circulation. 1995;92:13931398.
15. Galis ZS, Sukhova GK, Lark MW, Libby P. Increased expression of matrix metalloproteinases and matrix degrading activity in vulnerable regions of human atherosclerotic plaques. J Clin Invest. 1994;94:24932503.
16.
Brown DL, Hibbs MS, Kearney M, Loushin C, Isner
JM. Identification of 92-kD gelatinase in human coronary
atherosclerotic lesions: association of active enzyme synthesis with
unstable angina. Circulation. 1995;91:21252131.
17.
Moreno PR, Falk E, Palacios IF, Newell JB, Fuster
V, Fallon JT. Macrophage infiltration in acute coronary
syndromes: implications for plaque rupture. Circulation. 1994;90:775778.
18.
Buja LM, Willerson JT. Role of inflammation in
coronary plaque disruption. Circulation. 1994;89:503505.
19.
van der Wal AC, Piek JJ, de Boer OJ, Koch KT,
Teeling P, van der Loos CM, Becker AE. Recent activation of the plaque
immune response in coronary lesions underlying acute
coronary syndromes. Heart. 1998;80:1418.
20.
Mann JM, Kaski JC, Pereira WI, Arie S, Ramires
JA, Pileggi F. Histological patterns of atherosclerotic
plaques in unstable angina patients vary according to clinical
presentation. Heart. 1998;80:1922.
21. Welgus HG, Campbell EJ, Curry JD, Eisen AZ, Senior RM, Wilhelm SM, Golberg GI. Neutral metalloproteinases produced by human mononuclear phagocytes: enzyme profile, regulation and cellular differentiation. J Clin Invest. 1990;86:14961502.
22.
Halpert I, Sires UI, Roby JD, Potter-Perigo S,
Wight TN, Shapiro SD, Welgus HG, Wickline SA, Parks WC. Matrilysin is
expressed by lipid laden macrophages at sites of potential
rupture in atherosclerotic lesions and localises to areas of versican
deposition, a proteoglycan substrate for the enzyme. Proc Natl
Acad Sci U S A. 1996;93:97489753.
23.
Sukhova GK, Schonbeck U, Rabkin E, Schoen FJ, Poole AR,
Billinghurst RC, Libby P. Evidence for increased collagenolysis by
interstitial collagenases-1 and -3 in
vulnerable atheromatous plaques.
Circulation. 1999;99:25032509.
24.
Johnson JL, Jackson CL, Angelini GD, George SJ.
Activation of matrix-degrading metalloproteinases by mast cell
proteases in atherosclerotic plaques. Arterioscler Thromb Vasc
Biol. 1998;18:17071715.
25. Li Z, Li L, Zielke R, Cheng L, Xiao R, Crow M, Stetler-Stevenson WG, Froehlich J, Lakatta EG. Increased expression of 72-kD type IV collagenase (MMP2) in human aortic atherosclerotic lesions. Am J Pathol. 1996;148:121128.[Abstract]
26.
Ye S, Watts GF, Mandalia S, Humphries SE, Henney
AM. Preliminary report: genetic variation in the human stromelysin
promoter is associated with progression of coronary
atherosclerosis. Br Heart J. 1995;73:209215.
27.
Allaire E, Hasenstab D, Kenagy RD, Starcher B,
Clowes MM, Clowes AW. Prevention of aneurysm development and
rupture by local overexpression of plasminogen
activator inhibitor-1. Circulation. 1998;98:249255.
28.
Stemme S, Faber S, Holm J, Wiklund O, Witztum JL,
Hansson GK. T lymphocytes from human atherosclerotic plaques recognize
oxidized low density lipoprotein. Proc Natl Acad Sci
U S A. 1995;92:38933897.
29.
Muhlestein JB, Anderson JL, Hammond EH, Zhao L,
Trehan S, Schwobe EP, Carlquist JF. Infection with Chlamydia
pneumoniae accelerates the development of
atherosclerosis and treatment with azithromycin
prevents it in a rabbit model. Circulation. 1998;97:633636.
30. Riles TS, Imparato AM, Jacobowitz GR, Lamparello PJ, Giangola G, Adelman MA, Landis R, Kempezinski R, Hobson RW II, AbuRahma AF. The cause of perioperative stroke after carotid endarterectomy. J Vasc Surg. 1994;19:206216.[Medline] [Order article via Infotrieve]
31.
Davies M, Bland J, Hangartner J, Angelini A,
Thomas AC. Factors influencing the presence or absence of acute
coronary thrombi in sudden ischaemic death. Eur
Heart J. 1989;10:203208.
This article has been cited by other articles:
![]() |
D. Min, J. G. Lyons, J. Bonner, S. M. Twigg, D. K. Yue, and S. V. McLennan Mesangial cell-derived factors alter monocyte activation and function through inflammatory pathways: possible pathogenic role in diabetic nephropathy Am J Physiol Renal Physiol, November 1, 2009; 297(5): F1229 - F1237. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fortuno, J. Bidegain, P. A. Robador, J. Hermida, J. Lopez-Sagaseta, O. Beloqui, J. Diez, and G. Zalba Losartan Metabolite EXP3179 Blocks NADPH Oxidase-Mediated Superoxide Production by Inhibiting Protein Kinase C: Potential Clinical Implications in Hypertension Hypertension, October 1, 2009; 54(4): 744 - 750. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Menchen, I Marin-Jimenez, E G Arias-Salgado, T Fontela, P Hernandez-Sampelayo, M C G. Rodriguez, and N V Butta Matrix metalloproteinase 9 is involved in Crohn's disease-associated platelet hyperactivation through the release of soluble CD40 ligand Gut, July 1, 2009; 58(7): 920 - 928. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Amirbekian, J. G. S. Aguinaldo, S. Amirbekian, F. Hyafil, E. Vucic, M. Sirol, D. B. Weinreb, S. Le Greneur, E. Lancelot, C. Corot, et al. Atherosclerosis and Matrix Metalloproteinases: Experimental Molecular MR Imaging in Vivo Radiology, May 1, 2009; 251(2): 429 - 438. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H.F. Rudd, K. S. Myers, S. Bansilal, J. Machac, M. Woodward, V. Fuster, M. E. Farkouh, and Z. A. Fayad Relationships Among Regional Arterial Inflammation, Calcification, Risk Factors, and Biomarkers: A Prospective Fluorodeoxyglucose Positron-Emission Tomography/Computed Tomography Imaging Study Circ Cardiovasc Imaging, March 1, 2009; 2(2): 107 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fujimoto, D. Hartung, S. Ohshima, D. S. Edwards, J. Zhou, P. Yalamanchili, M. Azure, A. Fujimoto, S. Isobe, Y. Matsumoto, et al. Molecular Imaging of Matrix Metalloproteinase in Atherosclerotic Lesions: Resolution With Dietary Modification and Statin Therapy J. Am. Coll. Cardiol., December 2, 2008; 52(23): 1847 - 1857. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Welsh, P.H. Whincup, O. Papacosta, S.G. Wannamethee, L. Lennon, A. Thomson, A. Rumley, and G.D.O. Lowe Serum matrix metalloproteinase-9 and coronary heart disease: a prospective study in middle-aged men QJM, October 1, 2008; 101(10): 785 - 791. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Arenillas, J. Alvarez-Sabin, C. A. Molina, P. Chacon, I. Fernandez-Cadenas, M. Ribo, P. Delgado, M. Rubiera, A. Penalba, A. Rovira, et al. Progression of Symptomatic Intracranial Large Artery Atherosclerosis Is Associated With a Proinflammatory State and Impaired Fibrinolysis Stroke, May 1, 2008; 39(5): 1456 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Diamanti-Kandarakis, S. Livadas, S. A Kandarakis, A. Margeli, and I. Papassotiriou Serum concentrations of atherogenic proteins neutrophil gelatinase-associated lipocalin and its complex with matrix metalloproteinase-9 are significantly lower in women with polycystic ovary syndrome: hint of a protective mechanism? Eur. J. Endocrinol., April 1, 2008; 158(4): 525 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lancelot, V. Amirbekian, I. Brigger, J.-S. Raynaud, S. Ballet, C. David, O. Rousseaux, S. Le Greneur, M. Port, H. R. Lijnen, et al. Evaluation of Matrix Metalloproteinases in Atherosclerosis Using a Novel Noninvasive Imaging Approach Arterioscler Thromb Vasc Biol, March 1, 2008; 28(3): 425 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Taurino, S. Raffa, M. Mastroddi, V. Visco, L. Rizzo, M. R. Torrisi, and V. Faraglia Metalloproteinase Expression in Carotid Plaque and Its Correlation With Plasma Levels Before and After Carotid Endarterectomy Vascular and Endovascular Surgery, January 1, 2008; 41(6): 516 - 521. [Abstract] [PDF] |
||||
![]() |
C. D. Overton, P. G. Yancey, A. S. Major, M. F. Linton, and S. Fazio Deletion of Macrophage LDL Receptor-Related Protein Increases Atherogenesis in the Mouse Circ. Res., March 16, 2007; 100(5): 670 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zalba, A. Fortuno, J. Orbe, G. San Jose, M. U. Moreno, M. Belzunce, J. A. Rodriguez, O. Beloqui, J. A. Paramo, and J. Diez Phagocytic NADPH Oxidase-Dependent Superoxide Production Stimulates Matrix Metalloproteinase-9: Implications for Human Atherosclerosis Arterioscler Thromb Vasc Biol, March 1, 2007; 27(3): 587 - 593. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Abilleira, S. Bevan, and H. S Markus The role of genetic variants of matrix metalloproteinases in coronary and carotid atherosclerosis J. Med. Genet., December 1, 2006; 43(12): 897 - 901. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Eldrup, M.-L. M. Gronholdt, H. Sillesen, and B. G. Nordestgaard Elevated Matrix Metalloproteinase-9 Associated With Stroke or Cardiovascular Death in Patients With Carotid Stenosis Circulation, October 24, 2006; 114(17): 1847 - 1854. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-Y. Lee, W.-J. Kim, Y.-J. Kang, Y.-M. Jung, Y.-M. Kang, K. Suk, J.-E. Park, E.-M. Choi, B.-K. Choi, B. S. Kwon, et al. Z39Ig is expressed on macrophages and may mediate inflammatory reactions in arthritis and atherosclerosis J. Leukoc. Biol., October 1, 2006; 80(4): 922 - 928. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Lewandowski, J. Komorowski, D. P. Mikhalidis, M. Bienkiewicz, B. K. Tan, C. J. O'Callaghan, A. Lewinski, G. Prelevic, and H. S. Randeva Effects of Hormone Replacement Therapy Type and Route of Administration on Plasma Matrix Metalloproteinases and Their Tissue Inhibitors in Postmenopausal Women J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3123 - 3130. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Stoll and M. Bendszus Inflammation and Atherosclerosis: Novel Insights Into Plaque Formation and Destabilization Stroke, July 1, 2006; 37(7): 1923 - 1932. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Fiotti, N. Altamura, M. Fisicaro, N. Carraro, L. Uxa, G. Grassi, L. Torelli, R. Gobbato, G. Guarnieri, B. T. Baxter, et al. MMP-9 Microsatellite Polymorphism and Susceptibility to Carotid Arteries Atherosclerosis Arterioscler Thromb Vasc Biol, June 1, 2006; 26(6): 1330 - 1336. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sasaki, M. Kuzuya, K. Nakamura, X. W. Cheng, T. Shibata, K. Sato, and A. Iguchi A Simple Method of Plaque Rupture Induction in Apolipoprotein E-Deficient Mice Arterioscler Thromb Vasc Biol, June 1, 2006; 26(6): 1304 - 1309. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Meisner, D. Walcher, F. Gizard, X. Kapfer, R. Huber, A. Noak, L. Sunder-Plassmann, H. Bach, C. Haug, M. Bachem, et al. Effect of Rosiglitazone Treatment on Plaque Inflammation and Collagen Content in Nondiabetic Patients: Data From a Randomized Placebo-Controlled Trial Arterioscler Thromb Vasc Biol, April 1, 2006; 26(4): 845 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Aidinian, J. M. Weiswasser, S. Arora, C. J. Abularrage, N. Singh, and A. N. Sidawy Carotid Plaque Morphologic Characteristics Perspectives in Vascular Surgery and Endovascular Therapy, March 1, 2006; 18(1): 63 - 70. [Abstract] [PDF] |
||||
![]() |
K. C. Lewandowski, J. Komorowski, C. J. O'Callaghan, B. K. Tan, J. Chen, G. M. Prelevic, and H. S. Randeva Increased Circulating Levels of Matrix Metalloproteinase-2 and -9 in Women with the Polycystic Ovary Syndrome J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 1173 - 1177. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Slevin, A. B. Elasbali, M. Miguel Turu, J. Krupinski, L. Badimon, and J. Gaffney Identification of Differential Protein Expression Associated with Development of Unstable Human Carotid Plaques Am. J. Pathol., March 1, 2006; 168(3): 1004 - 1021. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Dollery and P. Libby Atherosclerosis and proteinase activation Cardiovasc Res, February 15, 2006; 69(3): 625 - 635. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. de Nooijer, C.J.N. Verkleij, J.H. von der Thusen, J.W. Jukema, E.E. van der Wall, Th. J.C. van Berkel, A.H. Baker, and E.A.L. Biessen Lesional Overexpression of Matrix Metalloproteinase-9 Promotes Intraplaque Hemorrhage in Advanced Lesions But Not at Earlier Stages of Atherogenesis Arterioscler Thromb Vasc Biol, February 1, 2006; 26(2): 340 - 346. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. R. W. Wilson, M. Anderton, E. C. Schwalbe, J. L. Jones, P. N. Furness, P. R.F. Bell, and M. M. Thompson Matrix Metalloproteinase-8 and -9 Are Increased at the Site of Abdominal Aortic Aneurysm Rupture Circulation, January 24, 2006; 113(3): 438 - 445. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Conover, L. K. Bale, S. C. Harrington, Z. T. Resch, M. T. Overgaard, and C. Oxvig Cytokine stimulation of pregnancy-associated plasma protein A expression in human coronary artery smooth muscle cells: inhibition by resveratrol Am J Physiol Cell Physiol, January 1, 2006; 290(1): C183 - C188. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-L. Hemdahl, A. Gabrielsen, C. Zhu, P. Eriksson, U. Hedin, J. Kastrup, P. Thoren, and G. K. Hansson Expression of Neutrophil Gelatinase-Associated Lipocalin in Atherosclerosis and Myocardial Infarction Arterioscler Thromb Vasc Biol, January 1, 2006; 26(1): 136 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P.G. Sluijter, W. P.C. Pulskens, A. H. Schoneveld, E. Velema, C. F. Strijder, F. Moll, J.-P. de Vries, J. Verheijen, R. Hanemaaijer, D. P.V. de Kleijn, et al. Matrix Metalloproteinase 2 Is Associated With Stable and Matrix Metalloproteinases 8 and 9 With Vulnerable Carotid Atherosclerotic Lesions: A Study in Human Endarterectomy Specimen Pointing to a Role for Different Extracellular Matrix Metalloproteinase Inducer Glycosylation Forms Stroke, January 1, 2006; 37(1): 235 - 239. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Soumian, R Gibbs, A Davies, and C Albrecht mRNA expression of genes involved in lipid efflux and matrix degradation in occlusive and ectatic atherosclerotic disease J. Clin. Pathol., December 1, 2005; 58(12): 1255 - 1260. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Krams, S. Verheye, L. C.A. van Damme, D. Tempel, B. M. Gourabi, E. Boersma, M. M. Kockx, M. W.M. Knaapen, C. Strijder, G. van Langenhove, et al. In vivo temperature heterogeneity is associated with plaque regions of increased MMP-9 activity Eur. Heart J., October 2, 2005; 26(20): 2200 - 2205. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Mezzetti Pharmacological modulation of plaque instability Lupus, September 1, 2005; 14(9): 769 - 772. [Abstract] [PDF] |
||||
![]() |
S. F. Ameriso, A. R. Villamil, C. Zedda, J. C. Parodi, S. Garrido, M. I. Sarchi, M. Schultz, J. Boczkowski, and G. E. Sevlever Heme Oxygenase-1 Is Expressed in Carotid Atherosclerotic Plaques Infected by Helicobacter pylori and Is More Prevalent in Asymptomatic Subjects Stroke, September 1, 2005; 36(9): 1896 - 1900. [Abstract] [Full Text] [PDF] |
||||
![]() |
O Y Bang, P H Lee, S R Yoon, M A Lee, I S Joo, and K Huh Inflammatory markers, rather than conventional risk factors, are different between carotid and MCA atherosclerosis J. Neurol. Neurosurg. Psychiatry, August 1, 2005; 76(8): 1128 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Soumian, C Albrecht, A. Davies, and R. Gibbs ABCA1 and atherosclerosis Vascular Medicine, May 1, 2005; 10(2): 109 - 119. [Abstract] [PDF] |
||||
![]() |
N. P. Kadoglou, S. S. Daskalopoulou, D. Perrea, and C. D. Liapis Matrix Metalloproteinases and Diabetic Vascular Complications Angiology, March 1, 2005; 56(2): 173 - 189. [Abstract] [PDF] |
||||
![]() |
A. S. Weyrich, M. M. Denis, J. R. Kuhlmann-Eyre, E. D. Spencer, D. A. Dixon, G. K. Marathe, T. M. McIntyre, G. A. Zimmerman, and S. M. Prescott Dipyridamole Selectively Inhibits Inflammatory Gene Expression in Platelet-Monocyte Aggregates Circulation, February 8, 2005; 111(5): 633 - 642. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Signorelli, G. Malaponte, M. Libra, L. D. Pino, G. Celotta, V. Bevelacqua, M. Petrina, G. S Nicotra, M. Indelicato, P. M Navolanic, et al. Plasma levels and zymographic activities of matrix metalloproteinases 2 and 9 in type II diabetics with peripheral arterial disease Vascular Medicine, February 1, 2005; 10(1): 1 - 6. [Abstract] [PDF] |
||||
![]() |
A. C. Newby Dual Role of Matrix Metalloproteinases (Matrixins) in Intimal Thickening and Atherosclerotic Plaque Rupture Physiol Rev, January 1, 2005; 85(1): 1 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. de Nooijer, J.H. von der Thusen, C.J.N. Verkleij, J. Kuiper, J.W. Jukema, E.E. van der Wall, Th.J.C. van Berkel, and E.A.L. Biessen Overexpression of IL-18 Decreases Intimal Collagen Content and Promotes a Vulnerable Plaque Phenotype in Apolipoprotein-E-Deficient Mice Arterioscler Thromb Vasc Biol, December 1, 2004; 24(12): 2313 - 2319. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Torzewski, P. Suriyaphol, K. Paprotka, L. Spath, V. Ochsenhirt, A. Schmitt, S.-R. Han, M. Husmann, V. B. Gerl, S. Bhakdi, et al. Enzymatic Modification of Low-Density Lipoprotein in the Arterial Wall: A New Role for Plasmin and Matrix Metalloproteinases in Atherogenesis Arterioscler Thromb Vasc Biol, November 1, 2004; 24(11): 2130 - 2136. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.J. Molloy, M.M. Thompson, J.L. Jones, E.C. Schwalbe, P.R.F. Bell, A.R. Naylor, and I.M. Loftus Unstable Carotid Plaques Exhibit Raised Matrix Metalloproteinase-8 Activity Circulation, July 20, 2004; 110(3): 337 - 343. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Randeva, K. C. Lewandowski, J. Komorowski, R. D. Murray, C. J. O'Callaghan, E. W. Hillhouse, H. Stepien, and S. M. Shalet Growth Hormone Replacement Decreases Plasma Levels of Matrix Metalloproteinases (2 and 9) and Vascular Endothelial Growth Factor in Growth Hormone-Deficient Individuals Circulation, May 25, 2004; 109(20): 2405 - 2410. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fournier, F. H. Messerli, J. M. Achard, and L. Fernandez Cerebroprotection mediated by angiotensin II: A hypothesis supported by recent randomized clinical trials J. Am. Coll. Cardiol., April 21, 2004; 43(8): 1343 - 1347. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Cipollone, B. Rocca, and C. Patrono Cyclooxygenase-2 Expression and Inhibition in Atherothrombosis Arterioscler Thromb Vasc Biol, February 1, 2004; 24(2): 246 - 255. [Abstract] [Full Text] |
||||
![]() |
M. Formato, M. Farina, R. Spirito, M. Maggioni, A. Guarino, G. M. Cherchi, P. Biglioli, C. Edelstein, and A. M. Scanu Evidence for a Proinflammatory and Proteolytic Environment in Plaques From Endarterectomy Segments of Human Carotid Arteries Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 129 - 135. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Hankey and J. W. Eikelboom Cyclooxygenase-2 Inhibitors: Are They Really Atherothrombotic, and If Not, Why Not? Stroke, November 1, 2003; 34(11): 2736 - 2740. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B Jones, D. C Sane, and D. M Herrington Matrix metalloproteinases: A review of their structure and role in acute coronary syndrome Cardiovasc Res, October 1, 2003; 59(4): 812 - 823. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nuotio, P. J. Lindsberg, O. Carpen, L. Soinne, E. M.P. Lehtonen-Smeds, E. Saimanen, R. Lassila, T. Sairanen, S. Sarna, O. Salonen, et al. Adhesion molecule expression in symptomatic and asymptomatic carotid stenosis Neurology, June 24, 2003; 60(12): 1890 - 1899. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Heo, S. H. Kim, K. Y. Lee, E. H. Kim, C. K. Chu, and J. M. Nam Increase in Plasma Matrix Metalloproteinase-9 in Acute Stroke Patients With Thrombolysis Failure Stroke, June 1, 2003; 34 (6): e48 - e50. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hashimoto, G. Wen, M. T. Lawton, N. J. Boudreau, A. W. Bollen, G.-Y. Yang, N. M. Barbaro, R. T. Higashida, C. F. Dowd, V. V. Halbach, et al. Abnormal Expression of Matrix Metalloproteinases and Tissue Inhibitors of Metalloproteinases in Brain Arteriovenous Malformations * Growth and Bleeding in BAVM: Another Role for MMPs Stroke, April 1, 2003; 34(4): 925 - 931. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Blankenberg, H. J. Rupprecht, O. Poirier, C. Bickel, M. Smieja, G. Hafner, J. Meyer, F. Cambien, L. Tiret, and for the AtheroGene Investigators Plasma Concentrations and Genetic Variation of Matrix Metalloproteinase 9 and Prognosis of Patients With Cardiovascular Disease Circulation, April 1, 2003; 107(12): 1579 - 1585. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Marx, J. Froehlich, L. Siam, J. Ittner, G. Wierse, A. Schmidt, H. Scharnagl, V. Hombach, and W. Koenig Antidiabetic PPAR{gamma}-Activator Rosiglitazone Reduces MMP-9 Serum Levels in Type 2 Diabetic Patients With Coronary Artery Disease Arterioscler Thromb Vasc Biol, February 1, 2003; 23(2): 283 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Morishige, H. Shimokawa, Y. Matsumoto, Y. Eto, T. Uwatoku, K. Abe, K. Sueishi, and A. Takeshita Overexpression of matrix metalloproteinase-9 promotes intravascular thrombus formation in porcine coronary arteries in vivo Cardiovasc Res, February 1, 2003; 57(2): 572 - 585. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Axisa, I. M. Loftus, A. R. Naylor, S. Goodall, L. Jones, P. R.F. Bell, M. M. Thompson, and C. Napoli Prospective, Randomized, Double-Blind Trial Investigating the Effect of Doxycycline on Matrix Metalloproteinase Expression Within Atherosclerotic Carotid Plaques * Editorial Comment Stroke, December 1, 2002; 33(12): 2858 - 2864. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ghilardi, M. L. Biondi, M. DeMonti, O. Turri, E. Guagnellini, and R. Scorza Matrix Metalloproteinase-1 and Matrix Metalloproteinase-3 Gene Promoter Polymorphisms Are Associated With Carotid Artery Stenosis Stroke, October 1, 2002; 33(10): 2408 - 2412. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Loftus and M. Thompson The role of matrix metalloproteinases in vascular disease Vascular Medicine, May 1, 2002; 7(2): 117 - 133. [Abstract] [PDF] |
||||
![]() |
A. J. Taylor, A. Bobik, M. C. Berndt, D. Ramsay, and G. Jennings Experimental Rupture of Atherosclerotic Lesions Increases Distal Vascular Resistance: A Limiting Factor to the Success of Infarct Angioplasty Arterioscler Thromb Vasc Biol, January 1, 2002; 22(1): 153 - 160. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-H. Lee, S.-H. Kim, Y. Lee, B. B. Lee, B. Kwon, H. Song, B. S. Kwon, and J.-E. Park Tumor Necrosis Factor Receptor Superfamily 14 Is Involved in Atherogenesis by Inducing Proinflammatory Cytokines and Matrix Metalloproteinases Arterioscler Thromb Vasc Biol, December 1, 2001; 21(12): 2004 - 2010. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. P. D'Armiento, A. Bianchi, F. de Nigris, D. M. Capuzzi, M. R. D'Armiento, G. Crimi, P. Abete, W. Palinski, M. Condorelli, C. Napoli, et al. Age-Related Effects on Atherogenesis and Scavenger Enzymes of Intracranial and Extracranial Arteries in Men Without Classic Risk Factors for Atherosclerosis Editorial Comment Stroke, November 1, 2001; 32(11): 2472 - 2480. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sangiorgi, R. D'Averio, A. Mauriello, M. Bondio, M. Pontillo, S. Castelvecchio, S. Trimarchi, V. Tolva, G. Nano, V. Rampoldi, et al. Plasma Levels of Metalloproteinases-3 and -9 as Markers of Successful Abdominal Aortic Aneurysm Exclusion After Endovascular Graft Treatment Circulation, September 18, 2001; 104 (2009): I-288 - I-295. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. G. Nadareishvili, D. E. Koziol, B. Szekely, C. Ruetzler, R. LaBiche, R. McCarron, T. J. DeGraba, and S. Jander Increased CD8+ T Cells Associated With Chlamydia pneumoniae in Symptomatic Carotid Plaque Editorial Comment Stroke, September 1, 2001; 32(9): 1966 - 1972. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Cipollone, C. Prontera, B. Pini, M. Marini, M. Fazia, D. De Cesare, A. Iezzi, S. Ucchino, G. Boccoli, V. Saba, et al. Overexpression of Functionally Coupled Cyclooxygenase-2 and Prostaglandin E Synthase in Symptomatic Atherosclerotic Plaques as a Basis of Prostaglandin E2-Dependent Plaque Instability Circulation, August 21, 2001; 104(8): 921 - 927. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Jian, P. L. Jones, Q. Li, E. R. Mohler III, F. J. Schoen, and R. J. Levy Matrix Metalloproteinase-2 Is Associated with Tenascin-C in Calcific Aortic Stenosis Am. J. Pathol., July 1, 2001; 159(1): 321 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jander, M. Sitzer, A. Wendt, M. Schroeter, M. Buchkremer, M. Siebler, W. Muller, W. Sandmann, and G. Stoll Expression of Tissue Factor in High-Grade Carotid Artery Stenosis : Association With Plaque Destabilization Stroke, April 1, 2001; 32(4): 850 - 854. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Stroke Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |