This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Grond-Ginsbach, C. Articles by Brandt, T. Search for Related Content PubMed PubMed Citation Articles by Grond-Ginsbach, C. Articles by Brandt, T. Related Collections Cell biology/structural biology Carotid and Vertebral A. Dissection Genetics of cardiovascular disease

(Stroke. 2000;31:1935.)
© 2000 American Heart Association, Inc.

Original Contributions

Mutations in the Tropoelastin Gene (ELN) Were Not Found in Patients With Spontaneous Cervical Artery Dissections

Caspar Grond-Ginsbach, PhD; Constanze Thomas-Feles, MD; Inge Werner; Ralf Weber, MD; Frank Wigger, MD; Ingrid Hausser, PhD Tobias Brandt, MD

From the Department of Neurology (C.G.-G., C.T.-F., R.W., F.W., T.B.) and the Department of Dermatology (I.W., I.H.), University of Heidelberg, Heidelberg, Germany.

Correspondence to Dr C. Grond-Ginsbach, Department of Neurology, University of Heidelberg, Im Neuenheimer Feld 400, D-69120 Heidelberg, Germany. E-mail Caspar Grond-Ginsbach{at}med.uni-heidelberg.de

	Abstract

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Background and Purpose—The majority of patients with spontaneous cerebral artery dissection show ultrastructural alterations in dermal collagen and elastic fibers.

Methods—We studied the gene encoding tropoelastin (ELN) by reverse transcription–polymerase chain reaction and subsequent sequence analysis in 10 patients with abnormalities in their elastic fibers.

Results—No mutations were found in the whole coding region of the ELN gene. The simultaneous visualization and quantification of ELN splice variants by gene scanning enabled the analysis of the regulation of alternative splicing of ELN mRNA. No differences could be detected between fibroblast cultures of the patients and a control subject.

Conclusions—Neither mutations in the ELN gene nor dysregulation of its activity appears to be the cause of the connective tissue disorder that is found in most patients with spontaneous dissections.

Key Words: dissections • RNA splicing, alternative • sequence analysis • tropoelastin

	Introduction

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Spontaneous dissections of the cervical arteries (sCADs) are increasingly recognized as a cause of stroke among young and middle-aged patients.¹ Ultrastructural abnormalities were found in skin biopsies of the majority of patients with sCADs, which suggests a predisposing generalized connective tissue disorder.² Major findings in the dermal connective tissue included enlarged and irregular collagen fibrils and pronounced elastic fiber fragmentation. The morphology of the ultrastructural aberrations resembled the morphology found in Ehlers-Danlos syndrome type II and III for the collagen changes and that found in the marfanoid or pseudoxanthoma elasticum phenotypes for the elastic fiber abnormalities. Some known connective tissue disorders predispose for sCAD, but most sCAD patients do not display symptoms of a known hereditary syndrome.³ It is not known whether the multiple ultrastructural defects in the dermal connective tissue from sCAD patients depend primarily on a disorder of the collagen fiber system (with morphological alterations of the elastic fibers as secondary effects), whether aberrations of the elastic fibers are the fundamental defect, or whether some other factors in the assembly of the extracellular matrix are directly involved in the phenotype.

Elastic fibers are complex structures, composed of microfibrils and amorphous material. Fibrillin and various microfibril-associated proteins are found in the fibrillar part, whereas the amorphous part of the elastic fibrils consists mainly of elastin, a cross-linked form of posttranslationally modified tropoelastin.⁴ Several pathological conditions (supravalvular aortic stenosis, cutis laxa, and moyamoya disease) have been correlated with mutations in the gene encoding tropoelastin (ELN)^{5 6 7 8} or with dysregulation of ELN gene activity.⁹

In the present study, we investigate by direct sequence analysis the coding region of the ELN gene in sCAD patients with moderate to severe alterations in the morphology of the elastic fibers. Fibroblast cultures from 10 patients were analyzed. The pattern of alternative splicing of the ELN mRNA of the patients was also compared with ELN mRNA from a healthy control person.

	Subjects and Methods

Top Abstract Introduction Subjects and Methods Results Discussion References

 
From an initial series of 25 patients with sCADs, we selected 10 patients with pronounced morphological alterations in the dermal elastic fibers for the present study. None of the patients showed signs of a known connective tissue disorder.

Skin biopsies were taken from the outer side of the upper arm by open deep-knife biopsy. Part of the material was processed for electron microscopy according to Anton-Lamprecht.¹⁰ From another part of the biopsy, fibroblasts were cultured in MEM supplied with 10% FCS according to standard procedures.

RNA was prepared from cultured skin fibroblasts with RNA-zol (AGS-Heidelberg), and cDNA was synthesized with muLV Reverse Transcriptase and random hexamers (Perkin-Elmer). A mixture of deaza-dGTP and dGTP (3:1) was used for the first-strand cDNA synthesis. The whole coding sequence of the ELN cDNA was amplified by use of synergy Taq with proofreading activity from Natutec in a 20 µL volume in the presence of 7% dimethyl sulfoxide by nested polymerase chain reaction (PCR) in overlapping fragments. To each amplification, 0.5 µL cDNA was added, which corresponds to an initial 10 to 25 ng mRNA. After 22 cycles of amplification, the DNA was diluted 1:100. One microliter was amplified with a set of nested primer for another 22 cycles. After an initial denaturation for 1 minute at 94°C, the denaturation in each round of amplification was reduced to 5 seconds; annealing lasted 15 seconds at a temperature that was 5°C lower than the temperature of the primers. Primer extension was performed at 68°C for a duration of 1 minute for 1000 bp.

PCR primers were named according to their position on the sequence M36860 by Fazio et al,¹¹ except for primer 18855 (3' untranslated region), which was designed on the basis of the sequence U63721,¹² and +99 (exon 26A), which was designed on the basis of the sequence U93037.⁵ Forward primers are as follows: 00006 (ATAAAACGAGGTGCGGAG), 00027 (GGGCTGGGGCATTTCT), 00453 (GAGTGAAGCCTGGGAAAGT), 00926 (TGGAGGCATCGCAGGCGTTGGGACT), 00998 (GGAGCTGCTGCAGGCTTAGT), 01240 (CGGGGTTGGAGCTGGGGGCTTTCC), 01295FAM (GGAGTCGCAGGTGTCCCTAGTG), 01891 (CTCTCGGTGGAGTAGGCATCCCAG), and +099 (CCCTGAGCTCAGGGAAGGAGA). Reverse primers are as follows: 10571 (TGGAGCCTTGGGCTTAACTC), 10992 (ACTAAGCCTGCAGCAGCTCC), 11354 (CCTCCGACTCCGACACCAAAGCC), 11918 (CGGCGGGTCCGGCTCCCACCTCT), 12205 (TCTCTTCCGGCCACAAGCTTT), and 18855 (TAGCACCAACGTTGATGAGGTCGTG).

All amplification products were inspected after electrophoresis on a 2% agarose gel stained with ethidium bromide. FAM-labeled amplicons, synthesized with the primers 01295FAM and 12205, were run in POP-4 gel matrix (PE Biosystems) on a genetic analyzer (ABI Prism 310) and analyzed with Gene Scan software. A GS-1000-ROX molecular weight marker (PE Biosystems) was added to each separate run. The whole coding region of the ELN gene was amplified in a half-nested 2-step procedure with primers 00006 and 12205, followed by a second amplification with primers 00027 and 12205. The amplified DNA was cloned in a pCRII-TOPO vector (Invitrogen BV), single clones were picked, and the DNA was directly reamplified with M13 primers.

PCR products were prepared for dye terminator cycle sequence analysis (Perkin-Elmer) and analyzed by the ABI Prism 310 genetic analyzer according to the manufacturer’s instructions.

	Results

Top Abstract Introduction Subjects and Methods Results Discussion References

 
Patients
The Table summarizes relevant clinical data of the patients. Three patients (Nos. 5, 11, and 15) suffered from recurrent dissections. The father of patient 15 also suffered from a cervical artery dissection. Figure 1 shows the morphological abnormalities in the dermal elastic fibers from patient 16. Some of the fibers are fragmented and show an increased number of calcifications.

View this table: [in this window] [in a new window]   Table 1. Patients: Clinical History and Dermal Connective Tissue Diagnosis

View larger version (102K): [in this window] [in a new window]   Figure 1. Electron micrograph of dermal elastic fibers of patient 16 and of a normal control subject. A, Control subject. Normal mature elastic fiber in the reticular dermis shows an amorphous elastin core surrounded by elastotubules. Bar=0 1 µm. B, Elastic fiber aberrations in patient 16. Shown are focal electron-dense deposits representing minicalcifications (arrow) and pronounced fragmentation with a moth-eaten porous appearance. Bar=1 µm.

Alternative Splicing of ELN mRNA in Cultured Fibroblasts
We established fibroblast cultures from dermal biopsies of patients and a control person and analyzed the coding region of the ELN gene by reverse transcription PCR. After reverse transcription of total RNA from cultured fibroblasts, the whole coding region of the ELN gene was amplified in 4 overlapping fragments. Three of these amplified fragments were processed directly for cycle sequencing analyses. However, the 3' end of the cDNA is alternatively spliced, and various fragments of different length are produced by PCR. In cultured dermal fibroblasts, we observed 2 major cDNA variants of different length (peaks B and D in Figure 2). After cloning and sequencing of the PCR fragments, these were interpreted as different splice variants. Exons 22, 24A, and 26A were never found in 20 analyzed clones from region 0027 up to region 2236 of the ELN cDNA, encompassing the whole coding region. Exons 23, 32, and 33 were absent in some of the messengers because of alternative splicing. Major splice products can be visualized and quantified by gene scanning of regions 1295 through 2236 of the cDNA: the full-length mRNA (E, 9.7%), the mRNA without exon 32 (D, 42.0%), the mRNA without exons 32 and 33 (C, 3.3%), the mRNA without exons 32 and 23 (B, 34.8%), and the mRNA without exons 23, 32, and 33 (A, 4.2%). These 5 splice variants encompass 95% of the total amount of amplified ELN cDNA. However, various other splice variants are seen as small peaks in Figure 2. Moreover, with the aid of a PCR primer that anneals in exon 26A (an exon that is known to be rarely expressed), a product was generated in the cDNA samples of most patients (data not shown). Hence, an even higher number of splice variants of the ELN transcript is produced in at least some patients. The overall pattern of splice variants in cultured fibroblasts of different patients and of the control subject is similar (Figure 2, A through D).

View larger version (166K): [in this window] [in a new window]   Figure 2. Pattern of alternatively spliced ELN mRNA in cultured fibroblasts. Gene scan of amplified ELN cDNA from cultured fibroblasts from 5 patients (patients 5, 7, 11, 12, and 15, shown in the first 5 rows, respectively) and a control person (bottom row). Five major cDNA amplicons (A through E) are observed. These represent differently spliced mRNAs. The length of the FAM-labeled amplicons was estimated in relation to a ROX-labeled molecular weight marker. Because the electrophoretic mobility in POP-4 partially depends on the base composition of the DNA fragments, exact measurement of the length of the DNA fragments would require a molecular weight marker with a comparable sequence composition. Therefore, we sequenced individual clones from amplified cDNA of the whole coding region and analyzed individual transcripts by gene scanning. This enabled the identification of peak E as the full-length transcripts without exons 22, 24A, and 26A. Peaks A through D were interpreted as major splice variants.

Sequence Analysis of the Coding Region of the ELN mRNA
PCR fragments were cycle-sequenced in both directions. The obtained results were compared with the published consensus sequence.¹¹ No mutation was detected in any of the patients. Not analyzed were the sequences of exon 22, exon 24A, and exon 26A, because we never or rarely found these sequences expressed in our cDNA.

	Discussion

Top Abstract Introduction Subjects and Methods Results Discussion References

 
In earlier molecular genetic investigations of sCAD patients, mutations were found neither in the COL3A1 gene^{13 14} nor in COL5A1.¹⁵ Because pronounced alterations of the elastic fibers were also a frequent ultrastructural finding in patients with sCAD,² we hypothesized a mutation in the elastin-encoding gene ELN. The present investigation of the whole coding region of the ELN gene did not lead to the identification of mutations. Moreover, the pattern of alternatively spliced mRNAs and the relative proportion of the alternative transcripts seems normal for all samples tested. Therefore, neither mutations in the ELN gene nor dysregulation of its expression seems to be a relevant factor in the etiology of spontaneous cervical artery dissections.

For the present study, we selected sCAD patients without signs of a known connective tissue disorder and with strong morphological alterations of the dermal elastic fibers. In this subset of patients, we found 3 patients with recurrent dissections. Moreover, 1 of them had a first-degree relative (father) with a dissection too. The patients in the present study were selected according to such restrictive criteria that the falsification of our hypothesis of possible mutations in the ELN gene in patients with sCAD seems to be definite. It is remarkable that no female patients were found in this sample. It has been observed in a large series of patients with sCAD (T. Brandt, E. Orberk, R. Weber, unpublished data) that morphological connective tissue alterations are found more frequently in male sCAD patients than in female sCAD patients. Moreover, in the sample of female sCAD patients with morphological connective tissue aberrations, these aberrations are generally of a somewhat milder degree than those found in male patients.

The ELN gene was examined in the present study on the basis of RNA from cultured fibroblasts. This enabled both the rapid sequence analysis of large parts of the coding regions and the analysis of various splice products. However, the regulation of the transcriptional activity and of alternative splicing is known to be tissue specific. The expression of the ELN gene in cultured fibroblasts might differ substantially from the in vivo situation in the dermal connective tissue or in the tissues at risk (the vessel walls of the arteria carotis and arteria vertebralis).

Our investigation of the coding region of the ELN gene did not explain the observations made in dermal biopsies of patients with spontaneous cervical artery dissections. The cause for the abnormal morphology of the elastic fibers remains unclear. Either some other structural components of the elastic fiber or some of the many factors that regulate its biosynthesis might be defective, or the abnormal morphology of the elastic fiber is secondary.

Until now, the search for mutations in sCAD patients was not successful. However, an autosomal dominant inheritance of an ultrastructural connective tissue disorder was recently demonstrated in some families of patients with sCAD.¹⁶ The study of such pedigrees might enable the identification of further candidate genes that are involved in the pathogenesis of this disease.

	Acknowledgments

 
This study was supported in part by grants from the Deutsche Forschungsgemeinschaft (DFG) and the Deutsche Schlaganfall-Hilfe. We are indebted to Prof Werner Hacke for excellent working conditions.

Received December 6, 1999; revision received April 18, 2000; accepted April 18, 2000.

	References

Top Abstract Introduction Subjects and Methods Results Discussion References

 
1. Guillon B, Levy C, Bousser M-G. Internal carotid artery dissection: an update. J Neurol Sci. 1998;153:146–158.[Medline] [Order article via Infotrieve]

2. Brandt T, Hausser I, Orberk E, Grau A, Hartschuh W, Anton-Lamprecht I, Hacke W. Ultrastructural connective tissue abnormalities in patients with spontaneous cervico-cerebral artery dissections. Ann Neurol. 1998;44:281–285.[Medline] [Order article via Infotrieve]

3. Schievink WI, Wijdicks EFM, Michels VV, Vockley J, Godfrey M. Heritable connective tissue disorders in cervical artery dissections: a prospective study. Neurology. 1998;50:1166–1169.[Abstract/Free Full Text]

4. Indik Z, Yeh H, Ornstein-Goldstein N, Kucich U, Abrams W, Rosenbloom JC, Rosenbloom J. Structure of the elastin gene and alternative splicing of elastin mRNA: implications for human disease. Am J Med Genet. 1989;34:81–90.[Medline] [Order article via Infotrieve]

5. Li DY, Toland AE, Boak BB, Atkinson DL, Ensing GJ, Morris CA, Keating MT. Elastin point mutations cause an obstructive vascular disease, supravalvular aortic stenosis. Hum Mol Genet. 1997;6:1021–1028.[Abstract/Free Full Text]

6. Li DY, Faury G, Taylor DG, Davis EC, Boyle WA, Mecham RP, Stenzel P, Boak B, Keating MT. Novel arterial pathology in mice and humans hemizygous for elastin. J Clin Invest. 1998 15;102:1783–1787.

7. Tassabehji M, Metcalfe K, Hurst J, Ashcroft GS, Kielty C, Wilmot C, Donnai D, Read AP, Jones CJP. An elastin gene mutation producing abnormal tropoelastin and abnormal elastic fibres in a patient with autosomal dominant cutis laxa. Hum Mol Genet. 1998;7:1021–1028.[Abstract/Free Full Text]

8. Zhang MC, He L, Giro M, Yong SL, Tiller GE, Davidson JM. Cutis laxa arising from frameshift mutations in exon 30 of the elastin gene (ELN). J Biol Chem. 1999;8:274:981–986.

9. Yamamoto M, Aoyagi M, Tajima S, Wachi H, Fukai N, Matsushima Y, Yamamoto K. Increase in elastin gene expression and protein synthesis in arterial smooth muscle cells derived from patients with moyamoya disease. Stroke. 1997;28:1733–1738.[Abstract/Free Full Text]

10. Anton-Lamprecht I. The skin. In: Papadimitriou JM, Henderson DW, Spagnolo DV, eds. Diagnostic Ultrastructure of Non-Neoplastic Diseases. Edinburgh, UK: Churchill Livingstone; 1992:90–109.

11. Fazio MJ, Olsen DR, Kauh EA, Baldwin CT, Indik Z, Ornstein-Goldstein N, Yeh H, Rosenbloom J, Uitto J. Cloning of full-length elastin cDNAs from a human skin fibroblast recombinant cDNA library: further elucidation of alternative splicing utilizing exon-specific oligonucleotides. J Invest Dermatol. 1988;91:458–464.[Medline] [Order article via Infotrieve]

12. Osborne LR, Martindale DW, Scherer SW, Shi X-M, Huizenga J, Heng HHQ, Costa T, Pober B, Lew L, Brinkman J, Rommens J, Koop BF, Tsui L-C. Identification of genes from a 500-kb region at 7q11.23 that is commonly deleted in Williams syndrome patients. Genomics. 1996;36:328–336.[Medline] [Order article via Infotrieve]

13. Kuivaniemi H, Prockop DJ, Wu Y, Madhatheri SL, Kleinert C, Earley JJ, Jokinen A, Stolle C, Majamaa K, Myllyla VV, Norrgard O, Schievink WI, Mokri B, Fukawa O, ter Berg JWM, De Paepe A, Lozano AM, Leblanc R, Ryynanen M, Baxter BT, Shikata H, Ferell RE, Tromp G. Exclusion of mutations in the gene for type III collagen (COL3A1) as a common cause of intracranial aneurysms or cervical artery dissections: results from sequence analysis of the coding sequences of type III collagen from 55 unrelated patients. Neurology. 1993;43:2652–2658.[Abstract/Free Full Text]

14. van den Berg JS, Limburg M, Kappelle LJ, Pals G, Arwert F, Westerveld A. The role of type III collagen in spontaneous cervical arterial dissections. Ann Neurol. 1998;43:494–498.[Medline] [Order article via Infotrieve]

15. Grond-Ginsbach C, Weber R, Haas J, Orberk E, Kunz S, Busse O, Hausser I, Brandt T, Wildemann B. Mutations in the COL5A1 coding sequence are not common in patients with spontaneous cervical artery dissections (sCAD). Stroke. 1999;30:1887–1890.[Abstract/Free Full Text]

16. Grond-Ginsbach C, Hausser I, Orberk E, Weber R, Wigger F, Brandt T. Familial connective tissue alterations in patients with spontaneous cervical artery dissections. Cerebrovasc Dis. 2000;10(suppl 2):37.

This article has been cited by other articles:

				S. Debette and H. S. Markus The Genetics of Cervical Artery Dissection: A Systematic Review Stroke, June 1, 2009; 40(6): e459 - e466. [Abstract] [Full Text] [PDF]

				M.-L. Arnold, C. Grond-Ginsbach, I. Hausser, T. Brandt, B. Krischek, I. Inoue, and H. Kasuya Collagen Morphology Is Not Associated With the Ala549Pro Polymorphism of the COL1A2 Gene * Response: Stroke, October 1, 2005; 36(10): 2068 - 2069. [Full Text] [PDF]

				S. M. Rubinstein, S. M. Peerdeman, M. W. van Tulder, I. Riphagen, and S. Haldeman A Systematic Review of the Risk Factors for Cervical Artery Dissection Stroke, July 1, 2005; 36(7): 1575 - 1580. [Abstract] [Full Text] [PDF]

				T. Brandt, E. Orberk, R. Weber, I. Werner, O. Busse, B. T. Muller, F. Wigger, A. Grau, C. Grond-Ginsbach, and I. Hausser Pathogenesis of cervical artery dissections: Association with connective tissue abnormalities Neurology, July 10, 2001; 57(1): 24 - 30. [Abstract] [Full Text] [PDF]

				W. I. Schievink Spontaneous Dissection of the Carotid and Vertebral Arteries N. Engl. J. Med., March 22, 2001; 344(12): 898 - 906. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Grond-Ginsbach, C. Articles by Brandt, T. Search for Related Content PubMed PubMed Citation Articles by Grond-Ginsbach, C. Articles by Brandt, T. Related Collections Cell biology/structural biology Carotid and Vertebral A. Dissection Genetics of cardiovascular disease