(Stroke. 2002;33:2192.)
© 2002 American Heart Association, Inc.
Original Contributions |
From the Departments of Neurology (C.G.-G., R.W., I.W., O.B., A.G., T.B.), Neurosurgery (H.S., H.H.S.), and Dermatology (I.H.), University of Heidelberg, Heidelberg, Germany; Department of Neurology, City Hospital of Minden (O.B.), Minden, Germany; and Department of Neurology, City Hospital of Krefeld (N.L.), Krefeld, Germany.
Correspondence to Dr C. Grond-Ginsbach, Department of Neurology, University of Heidelberg, Im Neuenheimer Feld 400, D-69120 Heidelberg, Germany. E-mail Caspar_Grond-Ginsbach{at}med.uni-heidelberg.de
| Abstract |
|---|
|
|
|---|
Methods Skin biopsies from 21 patients with intracranial aneurysms, many with multiple aneurysms, were studied by electron microscopy. None of the patients included in this study showed clinical signs of a known connective tissue disorder.
Results In 7 patients (33%), we observed repetitive aberrations in the morphology of collagen fibrils and elastic fibers of the reticular dermis. The observed ultrastructural findings were somewhat similar to those typically observed in patients with Ehlers-Danlos syndrome (EDS) and in a subgroup of patients with spontaneous cervical artery dissections. The patterns of abnormalities fell into 2 classes: 4 patients displayed abnormalities that resembled those found in patients with EDS type III, and the electron microscopic findings in the skin biopsies from 3 patients resembled those of EDS type IV patients. The sequence of the COL3A1 gene from the patients with EDS type IVlike alterations of the connective tissue morphology was analyzed. No mutation was detected.
Conclusions Connective tissue alterations were found in skin biopsies from a minority of patients with intracranial aneurysms. Electron microscopic investigation of skin biopsies from patients and their relatives might become valuable for clinical diagnostics, identification of persons at risk, and basic studies of the pathogenesis of this vascular disease.
Key Words: aneurysm connective tissue disorders hereditary disease microscopy, electron
| Introduction |
|---|
|
|
|---|
It is largely unknown why only some people develop IA and most do not. Some acquired changes in the arterial wall are likely to play a role because hypertension, smoking, and alcohol abuse are risk factors for SAH.5 Genetic factors are also thought to increase the risk of IA development and rupture because IA is associated with a variety of inherited conditions. For instance, the relative risk for a ruptured aneurysm is increased in the classic and vascular types of Ehlers-Danlos syndrome (EDS types I/II and IV) and in autosomal dominant polycystic kidney disease (PKD1 and PKD2).711 Some patients with IA without a known genetic disorder have a family history of IA, which furthermore suggests a role of genetic factors in those patients who do not suffer from a known connective tissue disorder.1215 Various research groups tried to identify candidate genes harboring disease-causing mutations or functional polymorphisms. However, no genetic factors have been found to be significantly associated with AI in nonsyndromic patients.1620 It is reasonable to expect a stronger impact of inborn risk factors in younger patients and in patients with multiple IAs. We therefore selected for this pilot study younger patients with multiple IAs or with a family history and excluded patients with known lifestyle risk factors.
Skin can still be regarded as a "window" to heritable disorders of connective tissue.21 Biochemical and ultrastructural investigations of a skin biopsy are useful for the diagnosis of connective tissue disorders, particularly as long as specific molecular tests are not yet available. In this study, we investigated skin biopsies of patients with IAs by light and electron microscopy. We analyzed the morphology of the connective tissue with the same histological and electron microscopic methods used for the histological and ultrastructural diagnosis of EDS, pseudoxanthoma elasticum, and cutis laxa.22,23
| Materials and Methods |
|---|
|
|
|---|
For the collection of the skin biopsies and the subsequent handling and preparation of the material, we followed a standardized protocol developed for the diagnosis of connective tissue disorders. Biopsies were obtained by open, deep knife biopsy from the outer aspect of the upper arm close to the elbow. Specimens were prepared for light microscopy and electron microscopy as described elsewhere.22 As a control group, 10 patients (6 men, 4 women; mean age, 41 years; no signs of connective tissue disorder) with acute cerebral ischemia of different (mostly cardioembolic) origins were studied.24 The performance of skin biopsies was approved by the local ethics committee (University of Heidelberg), and required informed consent was obtained from each patient.
For the analysis of the part of the COL3A1 gene that encodes the
1(III)-chain, we isolated RNA from cultured fibroblasts and synthesized cDNA with random hexamers as described elsewhere.25 The
1(III) encoding region was amplified in 6 overlapping fragments with the following primers: GTTCTCTGCGATGACATAATATGTGACGA/TGACCATCACTGCCTCGAGCACCGTCA, TGGTGAGCGAGGACGGCCAGGACTT/TTCCTGGTCCTCCTGGACTTCCGGGCA, TGGAGAACCTGGCAGAGATGGCGTCCC/AGTAGGACCCCTTGGGCCATCTTTCC, CCTGGTCTGCAAGGAATGCCTGGAGAAA/GGCCCTGGGCACCAGGCGATCCCTTCT, GGTGCTCCTGGCAG- CCCTGGAGTGTC/GGCAGCGGCTCCAACACCACCACAG, and GTCAGCAGGGTGCAATCGGCAGTCCA/ACAGAATACCTTGATAGCATCCA. The sequence of each fragment was analyzed in both directions and compared with the published consensus sequence of the COL3A1 gene (accession number X14420).26
| Results |
|---|
|
|
|---|
|
Electron micrographs of the reticular dermis of 2 patients are shown in the Figure. Several fibers in the collagen bundles of the skin of patient 1 were irregular with a so-called flowerlike appearance in cross section (arrows). Similar morphological aberrations are typically found in patients with EDS type III (hypermobility type).22 A different but again abnormal morphology was found in the connective tissue of patient 6. Irregular contours of collagen fibers were rarely found, but their diameter was slightly reduced and they were more variable than usual. The packing of the bundles was less dense and regular than in healthy control subjects. Moreover, the thickness of the reticular dermis was reduced. Such electron microscopic aberrations are characteristic of patients with EDS type IV (vascular type).22 The morphology of the elastic fibers was also abnormal in these patients (data not shown). In patient 1, elastic fibers were fragmented with electron dense calcified inclusions. In patient 6, compared with the collagen bundles, the elastic material was enriched in mass but did not show abnormal calcification or fragmentation (resembling EDS type IV). Despite the resemblance of the ultrastructural morphology, none of these patients with IA showed other typical symptoms of these EDS subtypes apart from the vascular symptoms. In 7 of our patients, we found such mild but reproducible aberrations. In 4 other patients,9,12,15,20 the electron microscopic findings were difficult to interpret. They were classified as normal, although the connective tissue morphology seemed to be somewhat irregular, but the aberrations were very mild.
|
The sequence of the whole
(I)III encoding region of the COL3A1 gene of the 3 patients with a EDS type IVlike electron microscopic morphology2,6,17 was analyzed after amplification of the COL3A1 cDNA and subsequent direct cycle sequencing. No mutations were found in the whole
1(III) encoding region of these patients.
| Discussion |
|---|
|
|
|---|
For this first investigation of skin biopsies from patients with IA, we excluded patients with known risk factors to focus on patients with a possible constitutional predisposition for IA but without signs of known connective tissue disorder. Our series of patients is apparently a nonrandom sample with a possible bias in the frequency and grade of connective tissue abnormalities because most patients selected for this study carried multiple aneurysms, whereas the proportion of them has been estimated to be about one third of the total population of patients.35 The results of this actual investigation should therefore not be generalized to the population of all patients with IA. This pilot study merely documents that some patients with IA without signs of known connective tissue disorder display alterations in the morphology of the connective tissue in the reticular dermis. A systematic and prospective study is needed to estimate the prevalence of this connective tissue disorder among all subjects with IA.
The standardization of tissue sampling, specimen preparation, and evaluation of electron microscopic observations is important for proper diagnosis of connective tissue disorders by electron microscope. We compared the ultrastructural morphology with a series of age-matched control subjects with stroke of other origin, evaluated a deep knife biopsy from the upper elbow, and analyzed only deeper parts of the reticular dermis to control for those factors that could increase the variability of the results, such as mechanical stress, aging, or ultraviolet ray exposure. Under these conditions, the presence of repetitive and constant alterations in the morphology of connective tissue is significant and must be interpreted as a pathological finding. Despite extensive experience with diagnostic skin biopsies, we had difficulty evaluating the ultrastructural findings of 4 patients. They were all classified as normal, although we could not exclude with certainty minor pathological findings. The finding of clearly pathological patterns of connective tissue morphology among 7 of 21 patients (33%) therefore might even be an underestimation.
The alterations in connective tissue in the reticular dermis of patients with IA have similarities with alterations found in patients with spontaneous cervical artery dissection.23,27 The ultrastructural morphology of the connective tissue suggests that some patients with IA and with spontaneous cervical artery dissection carry a defect in the extracellular matrix, leading to a structural defect in the arterial wall and predisposing for vascular diseases. The finding of electron microscopic alterations in the reticular dermis, however, is not specific for a particular disease. Comparable alterations are found in patients with EDS types II, III, and IV24 and in heterozygous carriers of pseudoxanthoma elasticum.23
The morphological alterations observed in the patients with definitely positive electron microscopy fell into 2 qualitatively different types: in 4 patients, we observed a pattern of abnormalities that is characteristic of patients with the hypermobility type of EDS (type III), and the aberrations in 3 other patients resemble those found in patients with vascular EDS (EDS type IV). Mutations in COL3A1 were not found in several studies of patients with IA.28,29 Typical COL3A1 mutations were also excluded in those 3 patients, despite their EDS type IVlike connective tissue. The patients with EDS type IVlike morphology therefore do not suffer from EDS type IV but appear to suffer from a different disorder with comparable electron microscopic findings in the skin but with a possibly different pathomechanism. The patients with EDS type IIIlike ultrastructural findings in the skin apparently do not suffer from hypermobility EDS because other typical symptoms were not present. However, as long as the molecular basis of EDS type III is unclear, there is no molecular test to exclude this subtype of EDS as an underlying disorder in patients with IA. In addition, a minor variant of EDS type III is possible.
The morphology of the collagen fibers of patients with EDS type IV differs essentially from the pattern seen in patients with the hypermobility type of EDS, and different genes are mutated in these patients. In analogy to the genetic heterogeneity of EDS subtypes, we speculate that our series of patients might also suffer from genetically heterogeneous diseases and that at least 2 different molecular defects will be found among them. In conclusion, a defect in the extracellular matrix, possibly predisposing for aneurysm formation, could be demonstrated in a subgroup of patients with IA.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received December 14, 2001; revision received January 14, 2002; accepted February 18, 2002.
| References |
|---|
|
|
|---|
2. Van Gijn J, Rinkel GJE. Subarachnoid hemorrhage: diagnosis, causes and management. Brain. 2001; 124: 249278.
3. Qureshi AI, Suarez JI, Parekh PD, Sung G, Geocadin R, Bhardwaj A, Tamargo RJ, Ulatowski JA. Risk factors for multiple intracranial aneurysms. Neurosurgery. 1998; 43: 2226.[CrossRef][Medline] [Order article via Infotrieve]
4. Juvela S. Risk factors for multiple intracranial aneurysms. Stroke. 2000; 31: 392397.
5. Ellamushi HE, Grieve JP, Jager HR, Kitchen ND. Risk factors for the formation of multiple intracranial aneurysms. J Neurosurg. 2001; 94: 728732.[Medline] [Order article via Infotrieve]
6. Brennan JW, Schwartz ML. Unruptured intracranial aneurysms: appraisal of the literature and suggested recommendations for surgery, using evidence-based medicine criteria. Neurosurgery. 2000; 47: 135913571.[Medline] [Order article via Infotrieve]
7. Pope FM, Kendall BE, Slapak GI, Kapoor R, McDonald WI, Compston DA, Mitchell R, Hope DT, Millar-Craig MW, Dean JC, et al. Type III collagen mutations cause fragile cerebral arteries. Br J Neurosurg. 1991; 5: 551574.[Medline] [Order article via Infotrieve]
8. Schievink WI. Genetics of intracranial aneurysms. Neurosurgery. 1997; 40: 651662.[CrossRef][Medline] [Order article via Infotrieve]
9. Nekrysh SY. Association between heritable connective tissue disorders and intracranial aneurysms. Surg Neurol. 2000; 54: 7778.[Medline] [Order article via Infotrieve]
10. Hademenos GJ, Alberts MJ, Awad I, Mayberg M, Shepard T, Jagoda A, Latchaw RE, Todd HW, Viste K, Starke R, Girgus MS, Marler J, Emr M, Hart N. Advances in the genetics of cerebrovascular disease and stroke. Neurology. 2001; 56: 9971008.
11. Watnick T, Phakdeekitcharoen B, Johnson A, Gandolph M, Wang M, Briefel G, Klinger KW, Kimberling W, Gabow P, Germino GG. Mutation detection of PKD1 identifies a novel mutation common to three families with aneurysms and/or very-early-onset disease. Am J Hum Genet. 1999; 65: 15611571.[CrossRef][Medline] [Order article via Infotrieve]
12. Alberts MJ, Quinones A, Graffagnino C, Friedman A, Roses AD. Risk of intracranial aneurysms in families with subarachnoid hemorrhage. Can J Neurol Sci. 1995; 22: 121125.[Medline] [Order article via Infotrieve]
13. Alberts MJ. Subarachnoid hemorrhage and intracranial aneurysms.In: Alberts MJ, ed. Genetics of Cerebrovascular Disease. New York, NY: Futura Publishing Co Inc; 1999.
14. Raaymakers TW. Aneurysms in relatives of patients with subarachnoid hemorrhage: frequency and risk factors: MARS Study Group: Magnetic Resonance Angiography in Relatives of Patients with Subarachnoid Hemorrhage. Neurology. 1999; 53: 982988.
15. Nakagawa T, Hashi K, Kurokawa Y, Yamamura A. Family history of subarachnoid hemorrhage and the incidence of asymptomatic, unruptured cerebral aneurysms. J Neurosurg. 1999; 91: 391395.[CrossRef][Medline] [Order article via Infotrieve]
16. Onda H, Kasuya H, Yoneyama T, Takakura K, Hori T, Takeda J, Nakajima T, Inoue I. Genomewide-linkage and haplotype-association studies map intracranial aneurysm to chromosome 7q11. Am J Hum Genet. 2001; 69: 804819.[CrossRef][Medline] [Order article via Infotrieve]
17. Zhang B, Dhillon S, Geary I, Howell WM, Iannotti F, Day IN, Ye S. Polymorphisms in matrix metalloproteinase-1, -3, -9, and -12 genes in relation to subarachnoid hemorrhage. Stroke. 2001; 32: 21982202.
18. Yoon S, Tromp G, Vongpunsawad S, Ronkainen A, Juvonen T, Kuivaniemi H. Genetic analysis of MMP3, MMP9, and PAI-1 in Finnish patients with abdominal aortic or intracranial aneurysms. Biochem Biophys Res Commun. 1999; 265: 563568.[CrossRef][Medline] [Order article via Infotrieve]
19. Takenaka K, Sakai H, Yamakawa H, Yoshimura S, Kumagai M, Yamakawa H, Nakashima S, Nozawa Y, Sakai N. Polymorphism of the endoglin gene in patients with intracranial saccular aneurysms. J Neurosurg. 1999; 90: 935938.[Medline] [Order article via Infotrieve]
20. Takenaka K, Yamakawa H, Sakai H, Yoshimura S, Murase S, Okumura A, Nakatani K, Kimura T, Nishimura Y, Yoshimi N, Sakai N. Angiotensin I-converting enzyme gene polymorphism in intracranial saccular aneurysm individuals. Neurol Res. 1998; 20: 607611.[Medline] [Order article via Infotrieve]
21. Holbrook KA, Byers PH. Skin is a window on heritable disorders of connective tissue. Am J Med Genet. 1989; 34: 105121.[CrossRef][Medline] [Order article via Infotrieve]
22. Hausser I, Anton-Lamprecht I. Differential ultrastructural aberrations of collagen fibrils in Ehlers-Danlos syndrome types I-IV as a means of diagnostics and classification. Hum Genet. 1994; 93: 394407.[Medline] [Order article via Infotrieve]
23. Bacchelli B, Quaglino D, Gheduzzi D, Taparelli F, Boraldi F, Trolli B, Le Saux O, Boyd CD, Ronchetti IP. Identification of heterozygote carriers in families with a recessive form of pseudoxanthoma elasticum (PXE). Mod Pathol. 1999; 12: 11121123.[Medline] [Order article via Infotrieve]
24. Brandt T, Hausser I, Orberk E, Grau A, Hartschuh W, Anton-Lamprecht I, Hacke W. Ultrastructural connective tissue abnormalities in patients with spontaneous cervico-cerebral artery dissections. Ann Neurol. 1998; 44: 281285.[CrossRef][Medline] [Order article via Infotrieve]
25. Grond-Ginsbach C, Weber R, Haas J, Orberk E, Kunz S, Busse O, Hausser I, Brandt T, Wildemann B. Mutations in the COL5A1 coding sequence are not common in patients with spontaneous cervical artery dissections. Stroke. 1999; 30: 18871890.[Medline] [Order article via Infotrieve]
26. Ala-Kokko L, Kontusaari S, Baldwin CT, Kuivaniemi H, Prockop DJ. Structure of cDNA clones coding for the entire prepro alpha 1 (III) chain of human type III procollagen: differences in protein structure from type I procollagen and conservation of codon preferences. Biochem J. 1989; 260: 509514.[Medline] [Order article via Infotrieve]
27. Brandt T, Orberk E, Weber R, Werner I, Busse O, Muller B, Wigger F, Grau A, Grond-Ginsbach C, Hausser I. Pathogenesis of cervical artery dissections: association with connective tissue abnormalities. Neurology. 2001; 57: 2430.
28. Kuivaniemi H, Prockop DJ, Wu Y, Madhatheri SL, Kleinert C, Earley JJ, Jokinen A, Stolle C, Majamaa K, Myllyla VV, Norrgard O, Schievink WI, Mokri B, Fukawa O, ter Berg JWM, De Paepe A, Lozano AM, Leblanc R, Ryynanen M, Baxter BT, Shikata H, Ferell RE, Tromp G. Exclusion of mutations in the gene for type III collagen (COL3A1) as a common cause of intracranial aneurysms or cervical artery dissections: results from sequence analysis of the coding sequences of type III collagen from 55 unrelated patients. Neurology. 1993; 43: 26522658.
29. van den Berg JS, Pals G, Arwert F, Hennekam RC, Albrecht KW, Westerveld A, Limburg M. Type III collagen deficiency in saccular intracranial aneurysms: defect in gene regulation? Stroke. 1999; 30: 14281431.
This article has been cited by other articles:
![]() |
G Kuhlenbaumer, C Konrad, S Kramer, B Kis, D Nabavi, R Dittrich, and E B Ringelstein The collagen 1A2 polymorphism rs42524, which is associated with intracranial aneurysms, shows no association with spontaneous cervical artery dissection (sCAD) J. Neurol. Neurosurg. Psychiatry, January 1, 2006; 77(1): 124 - 125. [Full Text] [PDF] |
||||
![]() |
M.-L. Arnold, C. Grond-Ginsbach, I. Hausser, T. Brandt, B. Krischek, I. Inoue, and H. Kasuya Collagen Morphology Is Not Associated With the Ala549Pro Polymorphism of the COL1A2 Gene * Response: Stroke, October 1, 2005; 36(10): 2068 - 2069. [Full Text] [PDF] |
||||
![]() |
Y.M. Ruigrok, G.J.E. Rinkel, A. Algra, T.W.M. Raaymakers, and J. van Gijn Characteristics of intracranial aneurysms in patients with familial subarachnoid hemorrhage Neurology, March 23, 2004; 62(6): 891 - 894. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoneyama, H. Kasuya, H. Onda, H. Akagawa, K. Hashiguchi, T. Nakajima, T. Hori, and I. Inoue Collagen Type I {alpha}2 (COL1A2) Is the Susceptible Gene for Intracranial Aneurysms Stroke, February 1, 2004; 35(2): 443 - 448. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Stroke Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2002 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |