| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Stroke. 2004;35:2801.)
© 2004 American Heart Association, Inc.
Original Contributions |
From the MRC Clinical Sciences Centre (C.A., J.S.A., A.S., C.F.H.), Faculty of Medicine, Imperial College, Hammersmith Hospital, Du Cane Road, London, UK; the Department of Vascular Surgery (S.S., A.H.D., R.G.J.G.), Faculty of Medicine, Imperial College, Charing Cross Hospital, Fulham Palace Road, London, UK. Current affiliation for C.A. is Physiology Weihenstephan, Technical University Munich, Weihenstephaner Berg 3, Freising, Germany.
Correspondence to Dr Richard Gibbs, Department of Vascular Surgery, Imperial College, Charing Cross Hospital, Fulham Palace Road, London W6 8RF. E-mail r.gibbs{at}ic.ac.uk
| Abstract |
|---|
|
|
|---|
Methods We compared the mRNA and protein levels of ABCA1, and one of its key regulators, the liver X receptor
(LXR
), between minimally and grossly atherosclerotic arterial tissue. We established ABCA1 and LXR
gene expression by real-time quantitative polymerase chain reaction in 10 control and 18 atherosclerotic specimens. Presence of ABCA1 protein was assessed by immunoblotting. To determine whether differences observed at a local level were reflected in the systemic circulation, we measured ABCA1 mRNA in leukocytes of 10 patients undergoing carotid endarterectomy and 10 controls without phenotypic atherosclerosis.
Results ABCA1 and LXR
gene expression were significantly elevated in atherosclerotic plaques (P<0.0001 and 0.03, respectively). The increased mRNA levels of ABCA1 and LXR
were correlated in atherosclerotic tissue (r=0.85; P<0.0001). ABCA1 protein expression was significantly reduced in plaques compared with control tissues (P<0.0001). There were no differences in leukocyte ABCA1 mRNA expression (P=0.67).
Conclusions ABCA1 gene and protein are expressed in minimally atherosclerotic human arteries. Despite significant upregulation of ABCA1 mRNA, possibly mediated via LXR
, ABCA1 protein is markedly reduced in advanced carotid atherosclerotic lesions. No differences in leukocyte ABCA1 expression were found, suggesting the plaque microenvironment may contribute to the differential ABCA1 expression. We propose that the decreased level of ABCA1 protein is a key factor in the development of atherosclerotic lesions.
Key Words: atherosclerosis ATP binding cassette transporter 1 carotid artery plaque carotid arteries polymerase chain reaction
| Introduction |
|---|
|
|
|---|
(LXR
)6 and peroxisome proliferator-activated receptor-
.7 Insights into ABCA1 function and roles in disease have been elucidated by overexpression8 and ABCA1 gene inactivation studies in mice,9 as well as observational studies in individuals deficient in ABCA1 because of gene mutations.10 Although the systemic effects of loss of function in ABCA1-deficient individuals is well-characterized, less is known about the potential role of the transporter in localized atheromatous disease in individuals without reported mutations in the gene.
Apart from its role in cholesterol efflux, ABCA1 is implicated in phosphatidylserine translocation between the leaflets of cell membranes11 and the engulfment of apoptotic cells.11 Apoptosis, phosphatidylserine externalization and lipid dysregulation play critical roles in the development and subsequent behavior of atherosclerotic plaques. ABCA1 is implicated in these processes, making the transporter a promising candidate in the context of atherosclerosis. The key question, therefore, is whether there is a localized arterial loss of ABCA1 function in relation to atherosclerotic disease.
To investigate both ABCA1 gene and protein expression in human carotid atherosclerotic disease, we analyzed ABCA1 mRNA and protein in atheromatous plaques taken from patients undergoing carotid endarterectomy (CEA) and compared it to human arteries obtained from controls with no phenotypic atherosclerotic disease. To gain insight into regulatory mechanisms involved in ABCA1 gene expression, we also measured mRNA expression of one of its key regulators, LXR
. As leukocytes are known to be involved in the pathogenesis of the atheromatous plaque,12 and because deficient leukocyte ABCA1 expression is implicated in increased susceptibility to atherosclerosis in animal studies,4 we analyzed ABCA1 mRNA expression in peripheral leukocytes.
| Methods |
|---|
|
|
|---|
The endarterectomy specimens consisted of the atheromatous plaque, together with adjacent intima and medial layers. The inferior mesenteric artery specimens were full-thickness and included the adventitial layer. Therefore, a greater preponderance of connective tissue would be expected in the control samples. Previous work indicates that ABCA1 is expressed primarily in macrophages within the atheromatous lesion,14 therefore ABCA1 expression levels are expected to be higher in CEA (with advanced atherosclerosis) than inferior mesenteric artery specimens (with mild atherosclerosis).
To assess leukocyte ABCA1 expression, peripheral venous blood was collected pre-operatively from a subgroup of 10 patients undergoing elective CEA for symptomatic carotid disease and 10 age- and sex-matched controls, phenotypically free of symptomatic atherosclerosis. There were no statistically significant differences between subjects and controls with respect to age and sex. The study had ethical approval from the Riverside Research Committee and informed consent was obtained from subjects. Demographic details of patient and control groups are listed in Tables 1 and 2
.
|
|
ABCA1 Gene Expression
RNA Isolation and cDNA Preparation
Plaques and control arteries were immediately snap-frozen in liquid nitrogen and stored at 80°C. Total RNA was extracted from approximately 30 mg of pulverized frozen tissue with the RNeasy Mini or Lipid Tissue Mini kit (Qiagen) according to the manufacturers instructions.
Leukocytes were isolated from 8 mL whole blood and total RNA was extracted using RNeasy Midi columns (Qiagen). Monocytes were isolated from whole blood of 11 individuals using magnetic beads technique (Dynal, product no. 113.09) according to the manufacturers instructions.
For cDNA synthesis, total RNA (100 ng for plaques/control arteries, 1 µg for leukocytes) was transcribed with a first strand cDNA synthesis kit for reverse-transcription polymerase chain reaction (Roche, UK), according to the suppliers instructions.
Real-Time Quantitative Reverse-Transcription Polymerase Chain Reaction
Primers and probe for Taqman analysis of ABCA1 mRNA were designed to span 2 adjacent exons with PrimerExpress software (PE Applied Biosystems). The forward primer was GGGAGGCTCCCGGAGTT (exon 3), the reverse primer was GTATAAAAGAAGCCTCCGAGCATC (exon 4), and the FAM-labeled probe, spanning exons 3 and 4, was AACTTTAACAAATCCATTGTGGCTCGCCTGT. 5'-3'-sequences for LXR
primers and probe were: CAAGTGTTTGCACTGCGTCT, CAGGAATGTTTGCCCTTCTC, and CACTTCTAGGAGGCAGCCAC. Single-tube Taqman analysis was performed on an ABI Prism 7700 sequence detection system with 300 nM of forward and reverse primers in the presence of 200 nM 5'FAM-3'TAMRA-tagged probe for ABCA1, and 900 nM of forward and reverse primers in the presence of 300 nM 5'FAM-3'TAMRA-tagged probe for LXR
.
The internal standard was ß-actin mRNA, assayed with commercially supplied reagents (PE Applied Biosystems). Reactions were performed in duplicate and contained 5 µL of 4-fold diluted (leukocytes) or undiluted (plaques and control arteries) cDNA in a total volume of 25 µL.
Quantitation
The amount of ABCA1 mRNA in cells was calculated according to the relative standard curve method described in the PE User bulletin number 2. Target quantity was calculated from the standard curve and normalized to ß-actin (arterial specimens, leukocytes) or GAPDH (leukocyte-monocyte correlation). Relative ABCA1 and LXR
levels were evaluated for at least 2 different RT reactions.
Total Membrane Preparation and Western Blotting
Samples were snap-frozen in liquid nitrogen and stored at 80°C. Total membrane fractions were prepared using a protocol based on an established method published by Rosenberg et al.15 Approximately 100 mg of pulverised sample was homogenized in lysis buffer (50 mmol/L mannitol, 2 mmol/L EDTA, 50 mmol/L Tris HCl pH 7.6, complete mini protease inhibitors; Roche). Nuclei and debris were pelleted by centrifugation at 500 x g for 10 min, and the supernatant loaded onto 600 µl of a 300 mmol/L mannitol, 2 mmol/L EDTA, 50 mmol/L Tris HCl pH 7.6 cushion. The total membrane fraction was pelleted by centrifugation at 100 000 x g for 45 minutes. The membrane pellet was resuspended in 40 µl of lysis buffer and incubated for one hour on ice with 50 U of benzonuclease (Sigma), then SDS added to a final concentration of 1%. Protein content was measured by Biorad Dc protein assay kit. 50 µg of membrane protein was loaded on a 7% SDS-PAGE gel and transferred onto polyvinylidine difluoride membranes (Immobilion-P; Millipore). Proteins were detected with a polyclonal antibody against ABCA1 (1:1500; Abcam, Cambridge, UK) and a monoclonal antibody against Na+/K+-ATPase (1:1000; Research Diagnostics, Flanders, NJ) followed by anti-rabbit or anti-mouse HRP secondary antibodies (1:1000; Dako Cytomation, Cambridgeshire, UK). Signal was visualised by chemiluminescence (Amersham ECL system).
Protein Quantification
The optical density (OD) of ABCA1 and Na+/K+-ATPase bands was determined using Metamorph software (Universal Imaging Corporation). The average digital signal per band was measured after subtraction of the appropriate background. The OD for each ABCA1 band was normalized to the corresponding average signal of the Na+/K+-ATPase band, estimated for the same sample as loading control. Data are shown as average±SEM.
Statistics
For statistical evaluations, the SAS 8.1 program package was used.16 Samples were tested for normality by using the UNIVARIATE procedure and the ShapiroWilk W test. To test differences between the patient and control groups and plaques and control arteries for significance, an analysis of variance based on least-square means was calculated by using the General Linear Model procedure. The model used was: Y=group+residual error. For statistical analysis of ABCA1 and LXR
mRNA expression, the logarithmic delta cycle threshold (ct) values (ct target genect ß-actin) were used. Sex differences between the patient and control groups were assessed using the
2 test (FREQ procedure). To evaluate the relationships between LXR
and ABCA1 in arterial specimens, Pearson correlations were calculated by using the CORR procedure. P<0.05 was considered significant.
| Results |
|---|
|
|
|---|
was measured. The increase in ABCA1 mRNA detected in plaques was paralleled by a significant >2-fold increase in average LXR
mRNA levels (P=0.0287). Interestingly, in plaque tissue, a significant correlation between ABCA1 and LXR
mRNA expression levels was found (Figure 2A; r=0.85, P<0.0001), whereas in control arteries no association was detected (Figure 2B; r=0.24, P=0.5070).
|
|
ABCA1 Protein Expression
To assess protein expression, immunoblot analysis was performed. Total membrane fractions of plaques and control arteries were tested with antibodies against ABCA1 (Figure 3A; upper bands) and Na+/K+-ATPase (Figure 3A, lower bands), a plasma membrane protein used to ascertain equal sample loading. In contrast to mRNA levels, ABCA1 protein expression was significantly lower in plaques than in control arteries. Semiquantitative analysis using the OD of the bands confirmed the marked difference between controls and plaques (P<0.0001; Figure 3B) and remained highly significant after normalization of ABCA1 expression to Na+/K+-ATPase (P=0.0004; Figure 3C). No difference with regard to the Na+/K+-ATPase loading control was found (P=0.8316; Figure 3B).
|
| Discussion |
|---|
|
|
|---|
We found both ABCA1 mRNA and protein were expressed in inferior mesenteric arteries with early asymptomatic atherosclerosis. Unsurprisingly, the histology of these age-matched control arteries showed early atheromatous changes (American Heart Association classification of atherosclerosis types I to III). These lesions ranging from foam cells to extracellular lipid pools in the intima do not result in clinically relevant sequelae, and may not progress to atheroma formation. The only previous report of ABCA1 localization in human atherosclerosis using in situ hybridization demonstrated that ABCA1 mRNA was predominantly localized to macrophages14 in atherosclerotic lesions. However, it was not detected in normal arterial tissue, possibly because of the lower detection sensitivity of the in situ hybridization technique as compared with the quantitative real-time polymerase chain reaction (PCR) method that was used in the current study. ABCA1 protein has been detected in human endothelial and smooth muscle cell cocultures,17 but there are no reports to date of ABCA1 protein detection in human arterial tissue in vivo. This study demonstrates the presence of ABCA1 protein in minimally atherosclerotic arteries.
The CEA specimens demonstrated significantly higher levels of ABCA1 mRNA compared with control arterial tissues. One potential source of confound might be related to the difference in drug usage between patient and control groups illustrated in Table 1. Therefore, linear regression modelling was used to assess ABCA1 expression in control and patient groups adjusted for age, sex, aspirin and statin usage. This analysis revealed that differences in ABCA1 expression between control and patient arteries remained significant once adjusted for drug usage (coef=0.646, P=0.001). This increase was not mirrored by an upregulation of ABCA1 mRNA expression in peripheral leukocytes. This implies the observed upregulation in mRNA occurs predominantly at localized sites of disease.
The increase in ABCA1 gene expression in diseased tissue is surprising given the fact that animal studies of ABCA1 inactivation, as well as human ABCA1 gene mutations, suggest loss of function is the key to lipid deposition and its sequelae. However, mRNA levels do not necessarily accurately reflect protein expression and, particularly for ABCA1, relative mRNA distribution in tissue shows significant discordance with protein expression patterns suggesting that post-transcriptional regulation may be important.18 The relationship between ABCA1 mRNA and protein expression was assessed by analyzing the same specimen for both parameters. In control arteries, ABCA1 gene expression was reflected by the presence of protein. Intriguingly, however, markedly lower levels of ABCA1 protein were present in advanced atherosclerotic lesions. Thus, despite increased transcription, a reduction in protein expression was observed. However, no positive or negative correlation was observed between the mRNA and protein levels in the control arteries and the plaques. This could be attributed to the low n-numbers, the semi-quantitative nature of the protein data and various other influences on the intracellular sterol levels that regulate gene expression.
There is evidence that the composition and microenvironment of the atherosclerotic plaque could be associated with ABCA1 protein degradation. In advanced atherosclerotic lesions, macrophages tend to accumulate large amounts of free cholesterol.19 Increased intracellular free cholesterol has been shown to accelerate the degradation of ABCA1 in macrophages.20 Long chain fatty acids present in the plaque21 can promote macrophage ABCA1 protein degradation.22 Furthermore, it has recently been demonstrated that ABCA1 contains a PEST sequence that appears to enhance protein degradation.23
We have shown that in atherosclerotic tissues, both ABCA1 and LXR
mRNA levels were upregulated, and a clear correlation between mRNA levels of both genes was found. Nuclear receptors act as cholesterol sensors that respond to elevated sterol concentrations.24 It has been previously shown in vitro that ABCA1 transcription is stimulated by LXR
and the retinoid X receptor,25 and the induction of ABCA1 expression reflected that of LXR
.26 Such a parallel increase in LXR
and ABCA1 mRNA was also found in our study. The observed upregulation of both LXR
and ABCA1 mRNA could be attributed to the oxysterol-rich environment inside the plaque potentially amplified by low ABCA1 protein levels. Increased degradation of ABCA1 protein could hypothetically diminish cellular cholesterol efflux, resulting in increased free cholesterol, enhanced intracellular oxysterol loading, and stimulation of regulatory pathways involving LXR
.6
In conclusion, this study has shown that both the ABCA1 gene and protein are expressed in mildly atherosclerotic arterial tissue in vivo. Advanced carotid atherosclerotic lesions are characterized by reduced ABCA1 protein levels despite significant upregulation of both ABCA1 and LXR
mRNA. This finding has potentially important clinical consequences. The observation that upregulation of ABCA1 mRNA fails to translate into ABCA1 protein implies that pharmacological targeting of the ABCA1 and LXR
pathways may not achieve the anticipated atheroprotective effect in advanced atherosclerotic lesions.
| Acknowledgments |
|---|
. The authors are indebted to Dr P. Cohen for histological assessment of the arterial specimens. This project was supported by the Stroke Association, grant number TSA 12/02, and the Medical Research Council. | Footnotes |
|---|
Received January 15, 2004; revision received July 30, 2004; accepted August 24, 2004.
| References |
|---|
|
|
|---|
2. Marcil M, Brooks-Wilson A, Clee SM, Roomp K, Zhang LH, Yu L, Collins JA, van Dam M, Molhuizen HO, Loubster O, Ouellette BF, Sensen CW, Fichter K, Mott S, Denis M, Boucher B, Pimstone S, Genest JJ, Kastelein JJ, Hayden MR. Mutations in the ABC1 gene in familial HDL deficiency with defective cholesterol efflux. Lancet. 1999; 354: 13411346.[CrossRef][Medline] [Order article via Infotrieve]
3. Oram JF, Lawn RM, Garvin MR, Wade DP. ABCA1 is the cAMP-inducible apolipoprotein receptor that mediates cholesterol secretion from macrophages. J Biol Chem. 2000; 275: 3450834511.
4. van Eck M, Bos IS, Kaminski WE, Orso E, Rothe G, Twisk J, Bottcher A, Van Amersfoort ES, Christiansen-Weber TA, Fung-Leung WP, Van Berkel TJ, Schmitz G. Leukocyte ABCA1 controls susceptibility to atherosclerosis and macrophage recruitment into tissues. Proc Natl Acad Sci U S A. 2002; 99: 62986303.
5. Langmann T, Klucken J, Reil M, Liebisch G, Luciani MF, Chimini G, Kaminski WE, Schmitz G. Molecular cloning of the human ATP-binding cassette transporter 1 (hABC1): evidence for sterol-dependent regulation in macrophages. Biochem Biophys Res Commun. 1999; 257: 2933.[CrossRef][Medline] [Order article via Infotrieve]
6. Schwartz K, Lawn RM, Wade DP. ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR. Biochem Biophys Res Commun. 2000; 274: 794802.[CrossRef][Medline] [Order article via Infotrieve]
7. Chawla A, Boisvert WA, Lee CH, Laffitte BA, Barak Y, Joseph SB, Liao D, Nagy L, Edwards PA, Curtiss LK, Evans RM, Tontonoz P. A PPAR gamma-LXR-ABCA1 pathway in macrophages is involved in cholesterol efflux and atherogenesis. Mol Cell. 2001; 7: 161171.[CrossRef][Medline] [Order article via Infotrieve]
8. Singaraja RR, Bocher V, James ER, Clee SM, Zhang LH, Leavitt BR, Tan B, Brooks-Wilson A, Kwok A, Bissada N, Yang YZ, Liu G, Tafuri SR, Fievet C, Wellington CL, Staels B, Hayden MR. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and ApoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1. J Biol Chem. 2001; 276: 3396933979.
9. Aiello RJ, Brees D, Bourassa PA, Royer L, Lindsey S, Coskran T, Haghpassand M, Francone OL. Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages. Arterioscler Thromb Vasc Biol. 2002; 22: 630637.
10. van Dam MJ, de Groot E, Clee SM, Hovingh GK, Roelants R, Brooks-Wilson A, Zwinderman AH, Smit AJ, Smelt AH, Groen AK, Hayden MR, Kastelein JJ. Association between increased arterial-wall thickness and impairment in ABCA1-driven cholesterol efflux: an observational study. Lancet. 2002; 359: 3742.[CrossRef][Medline] [Order article via Infotrieve]
11. Hamon Y, Broccardo C, Chambenoit O, Luciani MF, Toti F, Chaslin S, Freyssinet JM, Devaux PF, McNeish J, Marguet D, Chimini G. ABC1 promotes engulfment of apoptotic cells and transbilayer redistribution of phosphatidylserine. Nat Cell Biol. 2000; 2: 399406.[CrossRef][Medline] [Order article via Infotrieve]
12. Libby P. Inflammation in atherosclerosis. Nature. 2002; 420: 868874.[CrossRef][Medline] [Order article via Infotrieve]
13. Stary HC, Chandler AB, Dinsmore RE, Fuster V, Glagov S, Insull WJ, Rosenfeld ME, Schwartz CJ, Wagner WD, Wissler RW. A definition of advanced types of atherosclerotic lesions and a histological classification of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, Am Heart Association. Arterioscler Thromb Vasc Biol. 1995; 15: 15121531.
14. Lawn RM, Wade DP, Couse TL, Wilcox JN. Localization of human ATP-binding cassette transporter 1 (ABC1) in normal and atherosclerotic tissues. Arterioscler Thromb Vasc Biol. 2001; 21: 378385.
15. Rosenberg MF, Velarde G, Ford RC, Martin C, Berridge G, Kerr JD, Callaghan R, Schmidlin A, Wooding C, Linton KJ, Higgins CF. Repacking of the transmembrane domain of P-glycoprotein during the transport ATPase cycle. EMBO J. 2001; 20: 56155625.[CrossRef][Medline] [Order article via Infotrieve]
16. Anonymous SAS Version 8.e. SAS Institute, Inc. Cary, NC, US. SAS 1999.
17. Reddy ST, Hama S, Ng C, Grijalva V, Navab M, Fogelman AM. ATP-Binding Cassette Transporter 1 Participates in LDL Oxidation by Artery Wall Cells. Arterioscler Thromb Vasc Biol. 2002; 22: 18771883.
18. Wellington CL, Walker EK, Suarez A, Kwok A, Bissada N, Singaraja R, Yang YZ, Zhang LH, James E, Wilson JE, Francone O, McManus BM, Hayden MR. ABCA1 mRNA and protein distribution patterns predict multiple different roles and levels of regulation. Lab Invest. 2002; 82: 273283.[CrossRef][Medline] [Order article via Infotrieve]
19. Tabas I. Free cholesterol-induced cytotoxicity. A possible contributing factor to macrophage foam cell necrosis in advanced atherosclerotic lesions. Trends in Cardiovascular Medicine. 1997; 7: 256263.[CrossRef]
20. Feng B, Tabas I. ABCA1-mediated cholesterol efflux is defective in free cholesterol-loaded macrophages. Mechanism involves enhanced ABCA1 degradation in a process requiring full NPC1 activity. J Biol Chem. 2002; 277: 4327143280.
21. Felton CV, Crook D, Davies MJ, Oliver MF. Relation of plaque lipid composition and morphology to the stability of human aortic plaques. Arterioscler Thromb Vasc Biol. 1997; 17: 13371345.
22. Wang Y, Kurdi-Haidar B, Oram JF. Liver X receptor-mediated activation of macrophage stearoyl-CoA desaturase generates unsaturated fatty acids that destabilize ATP-binding cassette transporter A1. J Lipid Res. 2004; In press.
23. Wang N, Chen W, Linsel: A PEST sequence in ABCA1 regulates degradation by calpain protease and stabilization of ABCA1 by apoA-I. J Clin Invest. 2003; 111: 99107.[CrossRef][Medline] [Order article via Infotrieve]
24. Lu TT, Repa JJ, Mangelsdorf DJ. Orphan nuclear receptors as eLiXiRs and FiXeRs of sterol metabolism. J Biol Chem. 2001; 276: 3773537738.
25. Costet P, Luo Y, Wang N, Tall AR. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J Biol Chem. 2000; 275: 2824028245.
26. Laffitte BA, Joseph SB, Walczak R, Pei L, Wilpitz DC, Collins JL, Tontonoz P. Autoregulation of the human liver X receptor alpha promoter. Mol Cell Biol. 2001; 21: 75587568.
This article has been cited by other articles:
![]() |
O. Mani, M. T. Sorensen, K. Sejrsen, R. M. Bruckmaier, and C. Albrecht Differential expression and localization of lipid transporters in the bovine mammary gland during the pregnancy-lactation cycle J Dairy Sci, August 1, 2009; 92(8): 3744 - 3756. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Y. Choi, M. Rahmani, B. W. Wong, S. Allahverdian, B. M. McManus, J. G. Pickering, T. Chan, and G. A. Francis ATP-Binding Cassette Transporter A1 Expression and Apolipoprotein A-I Binding Are Impaired in Intima-Type Arterial Smooth Muscle Cells Circulation, June 30, 2009; 119(25): 3223 - 3231. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Paul, H. H. D. Meyer, K. Leidl, S. Soumian, and C. Albrecht A novel enzyme immunoassay specific for ABCA1 protein quantification in human tissues and cells J. Lipid Res., October 1, 2008; 49(10): 2259 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Burgess, P. F. Parkinson, M. M. Racke, V. Hirsch-Reinshagen, J. Fan, C. Wong, S. Stukas, L. Theroux, J. Y. Chan, J. Donkin, et al. ABCG1 influences the brain cholesterol biosynthetic pathway but does not affect amyloid precursor protein or apolipoprotein E metabolism in vivo J. Lipid Res., June 1, 2008; 49(6): 1254 - 1267. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. H. Tansley, B. L. Burgess, M. T. Bryan, Y. Su, V. Hirsch-Reinshagen, J. Pearce, J. Y. Chan, A. Wilkinson, J. Evans, K. E. Naus, et al. The cholesterol transporter ABCG1 modulates the subcellular distribution and proteolytic processing of {beta}-amyloid precursor protein J. Lipid Res., May 1, 2007; 48(5): 1022 - 1034. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Farke, E. Viturro, H. H. D. Meyer, and C. Albrecht Identification of the bovine cholesterol efflux regulatory protein ABCA1 and its expression in various tissues J Anim Sci, November 1, 2006; 84(11): 2887 - 2894. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Van Eck, R. R. Singaraja, D. Ye, R. B. Hildebrand, E. R. James, M. R. Hayden, and T. J.C. Van Berkel Macrophage ATP-Binding Cassette Transporter A1 Overexpression Inhibits Atherosclerotic Lesion Progression in Low-Density Lipoprotein Receptor Knockout Mice Arterioscler Thromb Vasc Biol, April 1, 2006; 26(4): 929 - 934. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Soumian, R Gibbs, A Davies, and C Albrecht mRNA expression of genes involved in lipid efflux and matrix degradation in occlusive and ectatic atherosclerotic disease J. Clin. Pathol., December 1, 2005; 58(12): 1255 - 1260. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Soumian, C Albrecht, A. Davies, and R. Gibbs ABCA1 and atherosclerosis Vascular Medicine, May 1, 2005; 10(2): 109 - 119. [Abstract] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Stroke Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |