Donate Help Contact The AHA Sign In Home
American Heart Association
Stroke
Search: search_blue_button Advanced Search
Stroke. 2004;35:e62-e64
Published online before print February 12, 2004, doi: 10.1161/01.STR.0000115754.20124.4F
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
35/3/e62    most recent
01.STR.0000115754.20124.4Fv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wagner, S.
Right arrow Articles by Grond-Ginsbach, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wagner, S.
Right arrow Articles by Grond-Ginsbach, C.
Related Collections
Right arrow Carotid and Vertebral A. Dissection
Right arrow Genetics of Stroke

(Stroke. 2004;35:e62.)
© 2004 American Heart Association, Inc.


Short Communication

MMP-9 Polymorphisms Are Not Associated With Spontaneous Cervical Artery Dissection

Simone Wagner, MD; Britta Kluge; James A. Koziol, PhD; Armin J. Grau, MD Caspar Grond-Ginsbach, PhD

From the Department of Neurology, University of Heidelberg, Heidelberg, Germany (S.W., B.K., A.J.G., C.G-G.), and Department of Molecular and Experimental Medicine, Scripps Research Institute, La Jolla, Calif (J.A.K.).

Correspondence to Simone Wagner, MD, Department of Neurology, University of Heidelberg, Im Neuenheimer Feld 400, 69120 Heidelberg, Germany. E-mail simone_wagner{at}med.uni-heidelberg.de

Abstract

Background and Purpose— Cervical artery dissection (CAD) is a common cause of ischemic stroke in young adults. Alteration in the structure of the vascular extracellular matrix has been described in CAD. Matrix metalloproteinases (MMPs) degrade extracellular matrix proteins and can lead to vascular damage.

Methods— We tested 2 different MMP-9 DNA polymorphisms, a CA repeat and a cytosine to thymidine transition in the promotor sequence, for frequency in 52 patients with CAD. We compared the results with those of 52 healthy controls.

Results— No differences were found in the allelic distribution of either polymorphism.

Conclusions— Alleles of these well-characterized functional polymorphisms of MMP-9 gene are not associated with structural alterations in the matrix of vessels of patients with CAD.


Key Words: dissection • metalloproteinases • polymorphism

Cervical artery dissection (CAD) is a connective tissue disorder that is a common cause of cerebral ischemia in young adults. Structural alterations of the extracellular matrix (ECM) in the vascular wall and also in the skin of these patients have been described.1 Hereditary connective tissue disorders, in particular the vascular Ehlers-Danlos syndrome (EDS), are known to be risk factors for spontaneous dissections.2 Therefore, a genetic cause for non-EDS–associated CAD is plausible. The matrix metalloproteinases (MMPs) can degrade ECM proteins. Increased expression of MMPs may be based on polymorphisms in the MMP gene. We tested the hypothesis that the DNA polymorphisms in MMP genes that are associated with protein expression3,4 are a risk factor for CAD.

Subjects and Methods

Blood was sampled from 52 CAD patients and 52 control subjects. The control subjects were randomly selected from healthy students and staff members of the Department of Neurology, living in the same area as the patients. None of the control subjects showed signs of any known connective tissue disorder. All individuals were white and German.

DNA was isolated from EDTA blood samples after SDS-proteinase-K digestion and phenol-chloroform extraction following standard procedures. For the amplification of the CA repeat in the MMP-9 promotor sequence, we used the primers CTGAGGGCCTGCGGTTTCCT and (FAM-labeled) CCTTGACAGGCAAGTGCTGACT. The sequence around the single nucleotide polymorphism (SNP) at position -1562 was amplified with the primers GCCTGGCACATAGTAGGCCC and CTTCCTAGCCAGCCGGCATC.

Microsatellite amplicons were analyzed with the GeneScan program after electrophoresis on POP6 gel on a ABI 310 Genetic Analyzer (Applied Biosystems) sequencer, as previously described.5 For restriction fragment length polymorphism analysis, the 435-bp polymerase chain reaction product containing the C-1562T SNP was digested with NspI restriction enzyme and run on a 2% agarose gel stained with ethidium bromide (Figure 1). Sequencing was performed in only a few individuals to confirm the nature of each band seen on the gels.



View larger version (76K):
[in this window]
[in a new window]
 
Figure 1. Agarose gel after digestion with restriction enzyme. Lane 1 is an example of a T/T genotype, lane 5 shows a C/T genotype, and the remaining lanes show C/C genotypes.

The study was approved by the local ethics committee.

We used {chi}2 analysis to test for deviations of genotype distributions from Hardy-Weinberg equilibrium and to assess differences in allele frequencies between cases and controls. Fisher exact tests were implemented in StatXact 5 (Cytel Software).

Results

The CAD patients comprised 30 men and 22 women (mean±SD age, 43.3±8.7 years). Of the 52 CAD patients, 22 had unilateral carotid artery dissections, 16 unilateral vertebral artery dissections, 6 bilateral carotid artery dissections, and 4 bilateral vertebral artery dissections. Four patients suffered from multiple dissections of both a carotid and a vertebral artery. There were 30 male and 22 female controls, with a mean±SD age of 41.8±11.5 years.

The microsatellite fragment analysis (Figure 2) revealed a fragment of 176 bp to be the most common, both in patients (62.5%) and in controls (56.7%). There was no statistically significant difference in the frequencies of the various fragments between patients and controls (Table, P=0.82, Fisher exact test).



View larger version (61K):
[in this window]
[in a new window]
 
Figure 2. Genotyping of the microsatellite marker in the MMP-9 promoter. Genotyping of DNA samples from 4 CAD patients is shown. The length of the analyzed DNA fragments (expressed in base pairs) is indicated above the top panel.


View this table:
[in this window]
[in a new window]
 
Allele Distribution: Healthy Controls Compared With Patients With Dissection

Genotype frequencies of the SNP resulting from a cytosine to thymidine (T) transition at position -1562 in the promoter region of MMP-9 in cases and controls are given in the Table. Both cases and controls were in Hardy-Weinberg equilibrium at this locus (P=0.26 for cases, P=0.33 for controls, Fisher exact test), and cases and controls did not significantly differ in genotype frequencies (P=0.24, Fisher exact test).

We subgrouped our 52 cases into those with more severe disease (bilateral or multiple; n=14) versus those with a single-vessel dissection (n=38). In the Table we present the genotype frequencies of the SNP resulting from a cytosine to thymidine (T) transition at position -1562 in the promoter region of MMP-9, as well as the frequencies of the various fragments. There was no indication that the allele distributions differed according to severity of disease: SNP analysis, P=0.51, Fisher exact test; fragment distributions, P=0.66, Fisher exact test.

Discussion

CAD is a disease with an underlying alteration in the structure of the vascular wall.1 In this condition, ultrastructural changes of the ECM have been described in the vessel wall and in the skin, suggesting a genetic predisposing cause. This is also suggested by the fact that hereditary connective tissue disorders such as EDS predispose to spontaneous CAD.2 Thus far, the tested candidate genes for mutations in ECM molecules, for example, collagen V, have been negative.5 An alternative pathophysiological mechanism could be vessel wall alteration by MMPs. Recently, naturally occurring sequence variations have been detected in the promotor region of MMP genes. These sporadic polymorphisms have been shown to have specific effects on the transcriptional activities of the relevant MMP gene promotors and to be associated with aneurysms. By analogy with functional and genetic studies on cerebral aneurysms and arteriosclerosis3,4 and in view of the increasing amount of literature on the association between MMP-9 and stroke6 as well as connective tissue diseases,7 we therefore have used the candidate gene approach to investigate the association between MMP-9 alleles and CAD.

We found no statistically significant differences in overall frequencies of the DNA fragments of the dinucleotide repeat length polymorphism and the allelic distribution of the SNP between the controls and patients. Nevertheless, the possibility of a type II error exists. In this regard, we have calculated that prospectively we would need a total sample size of 450 for a power of 0.90 to detect the difference in genotype frequencies observed in the Table with a standard 0.05 level {chi}2 test, and we would prospectively need an even larger sample size of 1800 for a power of 0.90, with a standard 0.05 level {chi}2 test, to detect the difference in allele frequencies observed in the Table. That is a much larger sample size than we could hope to recruit at our institution.

In conclusion, we did not find any evidence that MMP-9 gene is a marker of susceptibility for CAD, by both microsatellite and SNP analysis. Factors that are able to induce MMP-9, such as cytokines, may be better candidates as markers for susceptibility of CAD.

Acknowledgments

We thank Brunhilde Schagen for excellent technical assistance and Stefan Lehnert for help in preparing the figures. We thank Professor Werner Hacke for excellent working conditions.

Received June 9, 2003; revision received October 31, 2003; accepted November 10, 2003.

References

1. Brandt T, Orberk E, Weber R, Werner I, Busse O, Muller BT, Wigger F, Grau A, Grond-Ginsbach C, Hausser I. Pathogenesis of cervical artery dissections: association with connective tissue abnormalities. Neurology. 2001; 57: 24–30.[Abstract/Free Full Text]

2. North KN, Whiteman DA, Pepin MG, Byers PH. Cerebrovascular complications in Ehlers-Danlos syndrome type IV. Ann Neurol. 1995; 38: 960–964.[CrossRef][Medline] [Order article via Infotrieve]

3. Zhang B, Ye S, Herrmann SM, Eriksson P, de Maat M, Evans A, Arveiler D, Luc G, Cambien F, Hamsten A, et al. Functional polymorphism in the regulatory region of gelatinase b gene in relation to severity of coronary atherosclerosis. Circulation. 1999; 99: 1788–1794.[Abstract/Free Full Text]

4. Peters DG, Kassam A, St Jean PL, Yonas H, Ferrell RE. Functional polymorphism in the matrix metalloproteinase-9 promoter as a potential risk factor for intracranial aneurysm. Stroke. 1999; 30: 2612–2616.[Abstract/Free Full Text]

5. Grond-Ginsbach C, Weber R, Haas J, Orberk E, Kunz S, Busse O, Hausser I, Brandt T, Wildemann B. Mutations in the COL5A1 coding sequence are not common in patients with spontaneous cervical artery dissections. Stroke. 1999; 30: 1887–1890.[Medline] [Order article via Infotrieve]

6. Montaner J, Alvarez-Sabin J, Molina C, Angles A, Abilleira S, Arenillas J, Gonzalez MA, Monasterio J. Matrix metalloproteinase expression after human cardioembolic stroke: temporal profile and relation to neurological impairment. Stroke. 2001; 32: 1759–1766.[Abstract/Free Full Text]

7. Zucker S, Hymowitz M, Conner C, Zarrabi HM, Hurewitz AN, Matrisian L, Boyd D, Nicolson G, Montana S. Measurement of matrix metalloproteinases and tissue inhibitors of metalloproteinases in blood and tissues: clinical and experimental applications. Ann N Y Acad Sci. 1999; 878: 212–227.[CrossRef][Medline] [Order article via Infotrieve]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
35/3/e62    most recent
01.STR.0000115754.20124.4Fv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wagner, S.
Right arrow Articles by Grond-Ginsbach, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wagner, S.
Right arrow Articles by Grond-Ginsbach, C.
Related Collections
Right arrow Carotid and Vertebral A. Dissection
Right arrow Genetics of Stroke