Donate Help Contact The AHA Sign In Home
American Heart Association
Stroke
Search: search_blue_button Advanced Search
Stroke. 2004;35:e65-e67
Published online before print February 12, 2004, doi: 10.1161/01.STR.0000117095.96234.A6
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
35/3/e65    most recent
01.STR.0000117095.96234.A6v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fox, C. S.
Right arrow Articles by O’Donnell, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fox, C. S.
Right arrow Articles by O’Donnell, C. J.
Related Collections
Right arrow Pathophysiology
Right arrow Risk Factors
Right arrow Coagulation
Right arrow Other diagnostic testing
Right arrow Epidemiology
Right arrow Genetics of cardiovascular disease

(Stroke. 2004;35:e65.)
© 2004 American Heart Association, Inc.


Research Reports

Absence of Association Between Polymorphisms in the Hemostatic Factor Pathway Genes and Carotid Intimal Medial Thickness

The Framingham Heart Study

Caroline S. Fox, MD, MPH; Martin G. Larson, ScD; Diane Corey, MA; DaLi Feng, MD; Klaus Lindpaintner, MD; Joseph F. Polak, MD, MPH; Philip A. Wolf, MD; Ralph B. D’Agostino, PhD; Geoffrey H. Tofler, MD Christopher J. O’Donnell, MD, MPH

From the National Heart, Lung and Blood Institute’s Framingham Heart Study, Framingham, Mass (C.S.F., M.G.L., D.C., P.A.W., R.B.D., C.J.O.); National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Md (C.S.F., C.J.O.); Departments of Neurology and Preventive Medicine and Epidemiology, Boston University School of Medicine, Boston, Mass (M.G.L., P.A.W.); Department of Internal Medicine, Boston Medical Center, Boston, Mass (D.F.); Roche Genetics, Basel, Switzerland (K.L.); Department of Radiology, Brigham and Women’s Hospital, Harvard Medical School, Boston, Mass (J.F.P.); Department of Mathematics, Boston University, Boston, Mass (R.B.D.); Royal North Shore Hospital, Sydney University, Australia (G.H.T.); and Cardiology Division, Department of Medicine, Massachusetts General Hospital, Boston, Mass (C.J.O.).

Correspondence to Christopher J. O’Donnell, 73 Mt Wayte Ave, Suite 2, Framingham, MA 01702. E-mail chris{at}fram.nhlbi.nih.gov


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background and Purpose— Fibrinogen, plasminogen activator inhibitor-1, and other key proteins in the coagulation cascade have been implicated in the origin of cardiovascular disease. Polymorphisms in genes encoding these proteins have been associated with variability in plasma levels of these proteins. Carotid intimal medial thickness (IMT) is a heritable, quantitative measure of atherosclerosis that is predictive of subsequent myocardial infarction and stroke. We sought to test whether carotid IMT is associated with polymorphisms in several well-characterized genes in the hemostatic factor pathways.

Methods— Here, 867 men and 911 women (mean age, 57 years) in the Framingham offspring cohort underwent B-mode carotid ultrasonography to determine the mean internal (ICA) and common carotid artery (CCA) IMT. Age-, sex-, and multivariable-adjusted linear regression was used to estimate the association of the following variants with log-transformed CCA and ICA IMT: factor V Leiden, factor VII Arg/Gln, fibrinogen HindIII ß-148, plasminogen activator inhibitor-1 4G/5G, and the glycoprotein IIIa PlA2 polymorphism.

Results— Mean ICA IMT was 0.58 mm; mean CCA IMT was 0.60 mm. There were no differences in ICA or CCA IMT by genotype for any of the candidate genes in unadjusted, age- or sex-adjusted, and multivariable-adjusted models.

Conclusions— There is no evidence for an association between well-studied polymorphisms in the hemostatic factor genes and carotid IMT. Whether other common genetic variants in hemostatic factor genes are associated with subclinical atherosclerosis remains to be determined.


Key Words: coagulation • epidemiology • genetics • risk factors


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Carotid intimal medial thickness (IMT) is a subclinical measure of atherosclerosis that is predictive of subsequent myocardial infarction and stroke.1 Levels of a number of hemostatic factors, including factor VII,2 plasminogen activator inhibitor-1,3 and fibrinogen,4 have been shown to be associated with carotid IMT. However, it is not known whether hemostatic gene variants are associated with subclinical atherosclerosis determined by carotid IMT. We hypothesized that hemostatic factor gene variants may be associated with carotid IMT, and we tested variants in factor V, factor VII, fibrinogen, plasminogen activator inhibitor-1, and glycoprotein IIIa in the Framingham Heart Study offspring sample.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Study Sample
The Framingham Heart Study began in 1948 with an enrollment of 5209 men and women who were 28 to 62 years of age at study entry, with subjects undergoing repeated examinations every 2 years.5,6 In 1971, 5124 men and women were enrolled in the offspring cohort of the Framingham Heart Study, which included the children or spouses of the children of the original cohort. Offspring subjects underwent examinations approximately every 4 years; the design and methodology of the Framingham Offspring Cohort have been described previously.7,8 The current investigation comprises subjects from the Framingham Offspring Study undergoing B-mode carotid ultrasonography during examination cycle 6 (1996 through 1998). In total, 3532 participants attended this examination cycle. Of those, 3407 underwent carotid ultrasonography. Of these, 1778 subjects underwent genotyping for the hemostatic factor candidate gene polymorphisms. The cohort included 284 extended families ranging from 2 to 21 members. There were 1191 sibpairs, with sibships ranging from 2 to 7.

Each examination included an extensive cardiovascular disease assessment, 12-lead ECG, and blood testing. Measured covariates for the present study were assessed at the time of carotid ultrasonography.

Subjects underwent ultrasonography according to a standard protocol.1 Imaging was conducted by a single trained sonographer using a Toshiba SSH-140A imaging unit with a high-resolution 7.5-MHz transducer for the common carotid artery (CCA) and a 5.0-MHz transducer for the internal carotid artery (ICA).

Measurements were made by a single trained sonographer blinded to all clinical information and overread by 1 of the investigators (J.F.P.). Based on 25 replicate readings by 2 separate readers, correlation coefficients for the mean and maximum ICA were 0.83 and 0.84, respectively.

A number of previously described polymorphisms in several of the genes coding for hemostatic factors were characterized using previously published assay conditions. The factor V Leiden mutation (1691G->A) was genotyped according to standard protocol. Briefly, factor V Leiden results from a G-to-A substitution at nucleotide position 1691. A polymerase chain reaction (PCR)–based restriction fragment length polymorphism analysis was used, and genomic DNA was isolated from whole blood. The sequences of sense and antisense primers were 5'tgcccagtgcttaaacaagacca3' and 5'tgttatcacactggtgctaa3', respectively. The 4G/5G polymorphism of PAI-1 (1-BP DEL/INS 4G/5G) arises from an insertion/deletion of a guanidine (4 or 5 repeats) at position 675 in the PAI-1 promoter. We used a PCR-based analysis to detect the polymorphism. We amplified the region around the 4G/5G polymorphism. The sequences of the sense primer and antisense primer were 5'ggggcacagagagagtctggacac3' and 5'cggccgcctccgatgatac3', respectively. DNA was amplified with PCR. Samples were size fractionated on a polyacrylamide sequencing gel, and the PCR results were scored in a blinded fashion. Genotyping methods have been described previously for the fibrinogen HindIII ß-148 polymorphism (-148C->T),9 glycoprotein IIIa PlA2 polymorphism (1565T->C),10 and factor VII (10828G->A) polymorphism.11 The frequency of genotyping failures ranged from 2.3% (glycoprotein IIIa PlA2 polymorphism) to 2.9% (plasminogen activator inhibitor-1 4G/5G).

Descriptive statistics using means, medians, and standard deviations were performed on all variables when appropriate. The {chi}2 test was used to compare observed genotype frequencies with their estimates under Hardy-Weinberg equilibrium. To reduce nonnormality of distributions, CCA and ICA IMTs were log transformed. Multivariate linear regression, taking into account correlations among family members, was performed with SAS PROC MIXED.12 The general model was run first, and those with significant tests of trend were fit for additive, recessive, and dominant models. To accommodate multiple testing with 5 genes, we used a value of P<0.01 as a Bonferroni-adjusted test of significance. Multivariable analyses included adjustment for age, sex, systolic blood pressure, hypertension treatment, tobacco use (yes/no), total and high-density lipoprotein cholesterol, log triglycerides, diabetes, body mass index, and prevalent cardiovascular disease.

We calculated power to detect genetic effects in the context of a general model that uses 2 parameters to represent differences in genotype-specific means (ie, means µ1, µ2, and µ3). Assuming that measured covariates explain 20% of the overall variance (sex and age accounted for 17% of variance for ICA and 29% for CCA IMT), with a sample size of 1750 and 1% significance level, 80% power is attained for any genetic polymorphism that contributes at least 0.63% of the variance. For example, consider a diallelic gene with allele frequencies of 0.90 and 0.10 (genotype frequencies, 0.81, 0.18, 0.01); if genotype-specific means differed as 0.0, 0.19, and 0.38 SD units, the polymorphism would contribute 0.65% of total variance, and expected power would exceed 80%.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
The mean and SD of the ICA IMT were 0.58 and 0.38 mm, respectively. The 25th and 75th percentile values were 0.36 and 0.63 mm, respectively. The mean and SD of the CCA IMT were 0.60 and 0.15 mm, respectively; corresponding 25th and 75th percentile values were 0.51 and 0.65 mm.

Using 1 randomly selected sibling per nuclear family, we estimated allele frequencies and tested Hardy-Weinberg equilibrium for each gene. Allele frequencies for factor V Leiden, factor VII Arg/Gln, fibrinogen HindIII ß-148, plasminogen activator inhibitor-1 4G/5G, and glycoprotein IIIa PlA2 polymorphisms were 0.02, 0.15, 0.19, 0.47, and 0.15, respectively, for the rarer allele. Each of the polymorphisms was in Hardy-Weinberg equilibrium (all P>0.15).

Baseline characteristics are presented in Table 1. Unadjusted CCA and ICA IMTs by genotype for the different polymorphisms are shown in Table 2.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Baseline Characteristics of Study Sample (Mean±SD)


View this table:
[in this window]
[in a new window]
 
TABLE 2. Mean Internal Carotid Artery and Common Carotid Artery Thickness by Genotype (Mean±SE)

In unadjusted and age- plus sex-adjusted analyses, there were no differences in CCA IMT or ICA IMT across the 3 genotypes for any of the allelic variants of hemostatic factor pathway genes. In further age-, sex-, and multivariable-adjusted models, there continued to be no significant differences across genotypes.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The present study failed to detect any statistically significant associations of carotid IMT and several well-characterized polymorphisms in genes coding for hemostatic factors. Our findings render no evidence that similar associations exist with interindividual variability of subclinical carotid atherosclerosis.

Our results are consistent with those of several other studies. In studies that have examined the association between hemostatic factor genes and carotid IMT,13–15 there was no association between carotid IMT and the platelet glycoprotein IIb/IIIa PlA2 polymorphism,13 factor VII Arg/Gln polymorphism,15 or Arg/Gln polymorphism of the factor V Leiden gene.14

Our study has advantages over prior studies. We had a large sample size and an unselected sample of subjects. Furthermore, our study does not exclude the possibility that other genetic variants in these genes or other genes coding for additional elements of the hemostatic cascade may be associated with carotid IMT.

Although the present investigation failed to show an association between the polymorphisms examined and carotid IMT, it may still be of interest to explore more fully the possible association of carotid IMT with genetic variance by studying additional genetic variants in genes coding for hemostatic factors. In addition, it may be of interest to use other modalities to assess subclinical atherosclerosis such as electron beam CT and cardiac MRI that may add complementary information on IMT phenotype assessment.


*    Acknowledgments
 
This work was supported by the National Heart, Lung and Blood Institute’s Framingham Heart Study (N01-HC-25195), National Institute of Neurological Disorders and Stroke (NIH/NINDS 5R01-NS17950-20), and the Framingham Heart Study Visiting Scientist Program, which is supported by Servier Amerique.

Received October 23, 2003; accepted November 19, 2003.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. O’Leary DH, Polak JF, Kronmal RA, et al. Carotid-artery intima and media thickness as a risk factor for myocardial infarction and stroke in older adults: Cardiovascular Health Study Collaborative Research Group. N Engl J Med. 1999; 340: 14–22.[Abstract/Free Full Text]

2. Cortellaro M, Baldassarre D, Cofrancesco E, et al. Relation between hemostatic variables and increase of common carotid intima-media thickness in patients with peripheral arterial disease. Stroke. 1996; 27: 450–454.[Abstract/Free Full Text]

3. Marchesi E, Martignoni A, Tinelli C, et al. Plasminogen activator inhibitor-1 and carotid intima-media thickening in patients with newly detected primary hypertension. J Cardiovasc Risk. 1999; 6: 363–369.[Medline] [Order article via Infotrieve]

4. Metcalf PA, Folsom AR, Davis CE, Wu KK, Heiss G. Haemostasis and carotid artery wall thickness in non-insulin dependent diabetes mellitus. Diabetes Res Clin Pract. 2000; 47: 25–35.[CrossRef][Medline] [Order article via Infotrieve]

5. Dawber TR, Meadors GF, Moore FE. Epidemiologic approaches to heart disease: the Framingham study. Am J Public Health. 1951; 41: 279–286.[Free Full Text]

6. Dawber TR, Kannel WB, Lyell LP. An approach to longitudinal studies in a community: the Framingham Heart Study. Ann N Y Acad Sci. 1963; 107: 539–556.[Medline] [Order article via Infotrieve]

7. Feinleib M, Kannel WB, Garrison RJ, McNamara PM, Castelli WP. The Framingham Offspring Study: design and preliminary data. Prev Med. 1975; 4: 518–525.[CrossRef][Medline] [Order article via Infotrieve]

8. Kannel WB, Feinleib M, McNamara PM, Garrison RJ, Castelli WP. An investigation of coronary heart disease in families: the Framingham Offspring Study. Am J Epidemiol. 1979; 110: 281–290.[Abstract/Free Full Text]

9. O’Donnell CJ, Larson MG, Feng D, et al. Genetic and environmental contributions to platelet aggregation: the Framingham Heart Study. Circulation. 2001; 103: 3051–3056.[Abstract/Free Full Text]

10. Feng D, Lindpaintner K, Larson MG, et al. Increased platelet aggregability associated with platelet GPIIIa PlA2 polymorphism: the Framingham Offspring Study. Arterioscler Thromb Vasc Biol. 1999; 19: 1142–1147.[Abstract/Free Full Text]

11. Feng D, Tofler GH, Larson MG, et al. Factor VII gene polymorphism, factor VII levels, and prevalent cardiovascular disease: the Framingham Heart Study. Arterioscler Thromb Vasc Biol. 2000; 20: 593–600.[Abstract/Free Full Text]

12. SAS Institute Inc. SAS/STAT User’s Guide, Version 8. Cary, NC: SAS Institute Inc; 2000.

13. Garg UC, Arnett DK, Folsom AR, et al. Lack of association between platelet glycoprotein IIb/IIIa receptor PlA polymorphism and coronary artery disease or carotid intima-media thickness. Thromb Res. 1998; 89: 85–89.[CrossRef][Medline] [Order article via Infotrieve]

14. Garg UC, Arnett DK, Evans G, Eckfeldt JH. No association between factor V Leiden mutation and coronary heart disease or carotid intima media thickness: the NHLBI Family Heart Study. Thromb Res. 1998; 89: 289–293.[CrossRef][Medline] [Order article via Infotrieve]

15. Ghaddar HM, Folsom AR, Aleksic N, et al. Correlation of factor VIIa values with factor VII gene polymorphism, fasting and postprandial triglyceride levels, and subclinical carotid atherosclerosis. Circulation. 1998; 98: 2815–2821.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
StrokeHome page
J. F. Meschia
Clinically Translated Ischemic Stroke Genomics
Stroke, November 1, 2004; 35(11_suppl_1): 2735 - 2739.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
35/3/e65    most recent
01.STR.0000117095.96234.A6v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fox, C. S.
Right arrow Articles by O’Donnell, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fox, C. S.
Right arrow Articles by O’Donnell, C. J.
Related Collections
Right arrow Pathophysiology
Right arrow Risk Factors
Right arrow Coagulation
Right arrow Other diagnostic testing
Right arrow Epidemiology
Right arrow Genetics of cardiovascular disease