Donate Help Contact The AHA Sign In Home
American Heart Association
Stroke
Search: search_blue_button Advanced Search
Stroke. 2005;36:276-280
Published online before print December 16, 2004, doi: 10.1161/01.STR.0000151362.65339.f9
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
36/2/276    most recent
01.STR.0000151362.65339.f9v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gonzalez-Conejero, R.
Right arrow Articles by Vicente, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gonzalez-Conejero, R.
Right arrow Articles by Vicente, V.
Related Collections
Right arrow Aggregation
Right arrow Platelet function inhibitors
Right arrow Platelets
Right arrow Other Research

(Stroke. 2005;36:276.)
© 2005 American Heart Association, Inc.


Original Contributions

Biological Assessment of Aspirin Efficacy on Healthy Individuals

Heterogeneous Response or Aspirin Failure?

Rocio Gonzalez-Conejero, PhD; Jose Rivera, PhD; Javier Corral, PhD; Carmen Acuña, DSc; Jose A. Guerrero, DSc Vincente Vicente, PhD, MD

From the University of Murcia (R.G.-C., J.R., J.C.), Centro Regional de Hemodonación; and Hospital Morales Meseguer (C.A., J.A.G., V.V.), Centro Regional de Hemodonación, Murcia, Spain.

Correspondence to Dr Rocio González-Conejero, Centro de Hemodonación, Ronda de Garay s/n, 30003, Murcia, Spain. E-mail rocio.gonzalez{at}carm.es


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background and Purpose— The widespread use of aspirin requires clarification of the aspirin resistance phenomenon. Most studies on this field are focused on patients which may affect the action of aspirin.

Methods— We evaluated the biological efficacy of aspirin in healthy subjects.

Results— Agonist–induced platelet aggregation was fully abrogated by 100 mg of aspirin in all individuals. By contrast, with the platelet function analyzer-100 device, 33.3% of the subjects displayed no response. This failure was overcome by 500 mg or by in vitro treatment of blood with 30 µmol/L acetylsalicylic acid. Intake of 100 mg of aspirin efficiently reduced by 75% the level of 11-dehydro thromboxane B2 (11-dTxB2) in all cases. However, variability on the pre-aspirin level (range 72.4 to 625.9 ng/mmol creatinine) led to substantial differences in the residual amount of the metabolite between subjects treated with aspirin (range 12.9 to 118.0 ng/mmol creatinine). Finally, there was no influence of platelet glycoprotein IIb/IIIa (Pro33Leu), platelet glycoprotein Ia/IIa, (C807T), and FXIII (Val34Leu) polymorphisms on the efficacy of aspirin. However, the cyclooxygenase (Cox)-1 50T allele associated with higher level of 11-dTxB2, both before and after aspirin. Moreover, the Cox-2 –765C variant displayed a slightly higher reduction in 11-dTxB2 level on treatment with aspirin.

Conclusions— Our findings suggest that full resistance of healthy subjects to aspirin is rather unlikely. However, differences in aspirin absorption, or pharmacokinetic, or other unrecognized factors may lead to lack of effect of low dose of aspirin in some subjects when using tests like platelet function analyzer-100. Whether Cox polymorphisms are thrombotic risk factor for patients under aspirin will require further research.


Key Words: aspirin • platelet function tests • polymorphisms


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
A high percentage of patients still experience a vascular event despite aspirin treatment giving rise to the concept of aspirin resistance.1,2 The definition of the aspirin resistance phenomenon is controversial, and thus the reported range varies broadly, from 5% to 40%, depending on the assay used for identification and the population studied.2–4

From a biochemical point of view, aspirin resistance would refer to patients who are taking aspirin but do not display an adequate degree of platelet inhibition.3 Several laboratory tests are being used to assess the response to aspirin. Early reports have provided contradictory results based on measurements of platelet aggregation.5,6 More recent studies assessed the response to aspirin by measuring the urinary level of 11-dehydro thromboxane B2 (11-dTxB2) as an index of systemic generation of thromboxane A2. Again, inconclusive results have been reported.7,8 Currently, the most appealing test in clinical practice for assessment of platelet inhibition by aspirin is the platelet function analyzer (PFA)-100.9 By using this test, a high prevalence of aspirin resistance (20% to 40%) has been reported in various recent reports.4,9–11

Few studies have assessed the efficiency of the aspirin treatment in the same population using those different tests. Although some authors have reported correlation between the results of optical aggregometry and PFA-100,6 discrepancies have been also reported.4,10 Indeed, the lack of a suitable tool for identifying biological aspirin resistance is nowadays an aim of debate.12

Discrepancies in results among previous studies may likely rely on the fact that the individual response to aspirin is a continuous variable and may depend on interaction of acquired and genetics factors.13 Most previous studies involved patients whose particular atherothrombotic and inflammatory environment would largely influence the response to aspirin. Our current study investigating healthy subjects should reduce the degree of influence of acquired factors and would help to identify genetic factors involved in aspirin resistance. Our search has been focused on common genetic variations previously suggested to be associated with this phenomenon: cyclooxygenase (Cox)-1 (C50T),14 Cox-2 (G-765C),15 the fibrinogen receptor platelet glycoprotein (GP) IIb/IIIa (Pro33Leu), the platelet collagen receptor, GP Ia/IIa, (C807T), and the FXIII (Val34Leu).16,17


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The study involved 24 white healthy subjects from our staff (13 men and 11 women; 35.6±5.9 years). Among them, 4 were selected because of their GP IIIa 33Leu genotype, because this polymorphism had been often related to aspirin resistance. All of them had hematological and biochemical parameters within the normal range. Participants abstained from taking any drug for at least 2 weeks before enrolment. The study was conducted in agreement with the Declaration of Helsinki and was approved by a local ethical committee.

Study Design
Participants took 100 mg of aspirin (Bayer) after lunch on days 1 and 2 of the study. This guideline has been shown efficient to block production of TxA2 for the whole platelet life.18 Citrate anticoagulated venous blood and first morning urine specimen were collected on fasting conditions at day 1 (pre-aspirin sample) and thereafter at day 3.

In 7 individuals selected because of an apparent failure of response to 100 mg of aspirin, the study was repeated 2 weeks later with a dose of 500 mg. Also in these subjects, in vitro studies were performed by incubating untreated citrated whole blood with 30 µmol/L acetylsalicylic acid (Sigma-Aldrich) for 30 minutes at room temperature. Such concentration approaches the plasma concentration found in patients treated orally with 100 mg per day.19

When needed, platelet rich plasma and platelet poor plasma were obtained from citrated blood samples (0.129 mol/L citrate-containing tubes; Vacutainer, Becton Dickinson, Meylon, France). Functional studies were performed in platelet-rich plasma or whole blood within 2 hours of extraction. Urine and platelet-poor plasma samples were stored at –70°C until analysis. For cell counts, biochemical determinations and genotyping, additional blood samples were obtained in EDTA-containing tube (Vacutainer, Becton Dickinson).

Platelet Aggregation
Platelet aggregation was evaluated in citrated platelet- rich plasma (3x105 platelets/µL). Aggregation was induced with either 1 mmol/L arachidonic acid or collagen 10 µg/mL (Menarini Diagnostics). Changes in light transmission were recorded for a total time of 5 minutes using an Aggrecorder II aggregometer (Menarini Diagnostics).

11-Dehydro Thromboxane B2 Levels
The pre- and post-aspirin levels of 11-dTxB2 were determined in urine samples, by means of a commercially available ELISA (11-dehydro Thromboxane B2 EIA Kit Cayman Chemical) following the manufacturer’s instructions. All urine samples were assayed in duplicate, and the mean intra-assay coefficient of variation (CV, %) was 3.72±3.5. The interassay CV from 3 samples assayed in duplicate in 2 different days was 10.1±2.7.

Platelet Function Analyzer-100
Citrated whole blood was stabilized at room temperature for 30 minutes and tested in the PFA-100 (Dade Behring) using collagen-epinephrine cartridges. The closure time was recorded up to the upper device limit of 300 s.

Genotyping
Genotyping of GP IIIa, GP Ia, and FXIII polymorphisms was performed by polymerase chain reaction as previously described.20–22 Determination of the Cox-1 C50T and Cox-2 G-765C genotypes were performed by polymerase chain reaction–allelic restriction assay with Fau-I (Fermentas, Pascual and Furió) and single-stranded conformational polymorphism, respectively, using specific primers (Cox-1F: 5'GGTGCCCGGTGGGGAATTTTC3'; Cox-1B: 5'GAGGGGAAAGGAGGGGGTTG 3'; Cox-2F: 5'CCGCTTCCTTTGTCCATCAG3'; Cox-2B: 5'GGCTGTATATCTGCTCTATATGC3').

Statistical Analysis
Results are expressed as mean value±SD for continuous variables and as percentages for categorical variables. Differences between pre- and post-aspirin values were assessed by 2-tailed paired t test. Regression analysis was performed to assess significant correlation between pre- and post-aspirin values and between results from different tests. The influence of the investigated polymorphisms in the value of the distinct parameters, was evaluated by analysis of variance. The potential risk for failure of aspirin associated to these polymorphisms was assessed by the {chi}2 test. Differences among groups for each individual test were considered significant when uncorrected P<0.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Platelet Aggregation
All individuals displayed maximal platelet aggregation, both in response to arachidonic acid 1 mmol/L and collagen 10 µg/mL in pre-aspirin samples (mean percentage of aggregation, 88.1±6.6 and 79.31±11.6, respectively). This response was inhibited by more that 90% with aspirin 100 mg (mean percentage of aggregation, 3.7±1.2 and 4.2±1.3, respectively). Thus according to this test, all individuals can be classified as normal responders to aspirin 100 mg.

11-Dehydro Thromboxane B2 Levels
The 11-dTxB2 pre-aspirin levels were highly variable among subjects (mean, 179.5±142.0; range, 72.4 to 625.9 ng/mmol creatinine; CV=80%). After 100 mg of aspirin, we still observed a significant heterogeneity in the 11-dTxB2 levels (mean, 39.8±22.9; range, 12.9 to 118.0 ng/mmol creatinine; CV=58%), because all subjects displayed a high and rather uniform reduction in their 11-dTxB2 levels (mean percentage of reduction, 75.1±9.1; range, 55.1 to 87.5%; CV=12%). Regression analysis demonstrated that the post-aspirin level of 11- dTxB2 significantly correlated to the pre-aspirin level (R2=0.729; P=0.0001).

Platelet Function Analyzer-100
We observed a moderate variability on the pre-aspirin values of the closure time (128.7±26.3 s; range, 84 to 186 s; n=24; CV=20.5%). In 16 of 24 subjects (66.7%) the post-aspirin (100 mg) closure time exceeded the 300 s measurable by the device. All these subjects were therefore considered as normal responders to this dose of aspirin. However, in 8 of 24 subjects (33.3%), the closure time after aspirin remains below 300 s, and these subjects were considered as nonresponders to this aspirin dose (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Effect of In Vivo Treatment With High Dose of Aspirin (500 mg) or In Vitro Exposition of Platelet to Acetylsalicylic Acid on the PFA-100 Closure Times (s) of Healthy Subjects Displaying No Response to Low Dose (100 mg) of Aspirin

Of mention, the pre-aspirin closure time in these 7 nonresponders subjects (117.5±22.7 s) was not significantly different from that in the normal responders (134.4±26.8 s; P=0.14). Moreover, there were no significant differences among normal and nonresponders to 100 mg of aspirin in either hematocrit (41.8±3.8 versus 44.5±4.3%, P=0.13), leukocyte counts (6.2±1.2 versus 6.5±1.4; P=0.63) (x109/L), and platelet counts (244±47 versus 256±58; P=0.58) (x109/L). The von Willebrand factor antigen plasma levels (vWF:Ag, %) were also similar in these normal and abnormal responders to aspirin treatment (93.9±23.5 versus 111.7±21.7, before aspirin, P=0.21; 85.6±15.3 versus 93.7±16.1, after 2 days with aspirin, P=0.41)

Two weeks later, the individuals with apparent resistance to 100 mg of aspirin (subject K was excluded as he developed a mild allergic response to aspirin) were further investigated. We also selected 2 subjects with complete response to 100 mg of aspirin as controls (I and J). The pre-aspirin closure times were similar to those found previously (Table 1). As shown, both the intake of 500 mg of aspirin or the in vitro incubation caused prolongation of the closure times >300 s in all cases. According to these data, no subject can be classified as nonresponder to this high dose of aspirin or to the in vitro incubation of blood with a low acetylsalicylic acid dose.

Correlation Between 11-dTxB2 Level and PFA-100 Closure Time
The regression analysis revealed no statistical association between 11-dTxB2 levels and PFA-100 closure times, neither pre-aspirin (P=0.519) nor post-aspirin (P=0.445).

Genotype and Efficacy of Aspirin
The prevalence of C807T and FXIII genotypes was similar to that described in Mediterranean populations (Table 2).22,23 Moreover, the Cox-1 C50T and Cox-2 G-765C polymorphisms displayed similar frequencies than that previously described in other populations14,15 (Table 2).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Genotype Distribution of the Studied Subjects and Influence of Different Polymorphisms on PFA-100 Values and on Urine 11-dTxB2 Levels Before and After 100 mg of Aspirin

In all subjects, the platelet aggregation was maximal in absence of aspirin and negligible after intake of 100 mg of aspirin irrespective of their genotypes. Neither did we find association between these polymorphisms and PFA-100 values either pre- or post-aspirin (Table 2). Interestingly, the levels of 11-dTxB2 were significantly higher in carriers of the Cox-1 50T allele than in 50C carriers, both pre-aspirin (375.9±275 and 140.3±54.2 ng/mmol creatinine, respectively; P=0.001) and post-aspirin (62.1±43.7 and 35.4±14.7 ng/mmol creatinine, respectively; P=0.031). However, we observed no significant influence of this polymorphism on the reduction in 11-dTxB2 level after aspirin intake (P=0.104; Table 2). In contrast, we found a slight association between the impairment of 11-dTxB2 caused by 100 mg of aspirin and the Cox-2 genotype. Thus, the –765C carriers seemed to be more sensitive to this dose of aspirin than homozygous –765G subjects (P=0.041; Table 2).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
Many studies have addressed the aspirin resistance phenomenon, providing controversial results and reflecting the biological complexity of this concept.2,3 A current limitation of most previous studies is that they involved patients with an atherothrombotic and inflammatory background and already on aspirin treatment. These designs may underscore the aspirin response, because the pre-aspirin values for the different parameters investigated are not recorded. Our study largely differs from others by investigating the response to aspirin in healthy subjects, primarily lacking risk factors that may influence the effect of the drug. Moreover, the study of this population could help to clarify the role of common genetic changes on the heterogeneous response to aspirin.

Our results testing platelet aggregation before and after intake of low dose of aspirin (100 mg) further indicated that this test would unlikely be useful to screen for aspirin resistance in healthy people as it has been previously reported.24 By contrast, with PFA-100 testing we identified a high percentage of healthy subjects, similar to that found in patients,9–11 as nonresponders to low dose of aspirin. However, these individuals are by no means fully resistant to aspirin, because in all, a 5-fold increase in aspirin dose caused prolongation of the closure time above 300 s. Moreover, these subjects displayed closure times >300 s when untreated blood samples were incubated in vitro with 30 µmol/L aspirin. These findings suggest that the lack of response to 100 mg of aspirin may be related with reduced bioavailability of the drug. Indeed, individuals treated orally with low dose of aspirin display great interindividual differences in the plasma concentration–time profiles for acetylsalicylic acid.25 Our data are also in agreement with those reported by Alberts et al, who showed that the prevalence of aspirin-resistant patients in PFA-100 testing declines by {approx}50% by raising the aspirin treatment from 81 to 325 mg per day.26 Yet, there is still no conclusive evidence that increasing aspirin to tolerable levels could be clinically useful in patients behaving as resistant to low dose of aspirin.1,27 Although in this study the PFA-100 results of nonresponders to low dose of aspirin seem unrelated to significantly different hematocrit, platelet counts, or reduced vWF:Ag levels, the PFA-100 assay is not recognized as a specific test to measure responses to this drug, and to date the PFA-100 results have not been associated independently and consistently with the occurrence of recurrent vascular events in patients taking aspirin.9,28

Interestingly, we observed that 100 mg of aspirin causes a rather uniform 75% reduction in the urine concentration of 11-dTxB2 levels. Moreover, there was a significant correlation between the 11-dTxB2 levels before and after aspirin intake (P=0.0001). A recent study suggests that a level above 34 ng/mmol creatinine in patients could increase the risk of thrombotic events or even death.7 Although this suggestion requires further demonstration, our current data indicated that high levels of 11-dTxB2 post-aspirin could be anticipated by measuring the pre-aspirin levels. Whether high pre-aspirin 11-dTxB2 level could be a predictor of worse outcome or if it could identify patients who may benefit from alternative therapies that more effectively reduces in vivo thromboxane production, should be further investigated.

In this study, we found no relationship among the studied polymorphisms and a defective response to aspirin as evaluated with aggregometry or PFA-100. However, we observed that the Cox-1 50T variant associated with significantly higher levels of 11-dTxB2 (both in absence and presence of aspirin). In addition, the Cox-2 765C allele associated with a mild but significantly increased sensitivity to aspirin. This result supports the recent report of Cipollone et al,29 suggesting this polymorphism as an inherited protective factor against myocardial infarction and stroke.

In summary, this study in healthy subjects indicates that a full resistance to aspirin is unlikely. Thus, the apparent failure of response to low dose of aspirin observed in some individuals by PFA-100, which is not a specific test to measure response to this drug, is corrected by higher doses. Moreover, although the post-aspirin levels of 11-dTxB2 are largely dependent on the pre-aspirin levels, low dose of aspirin efficiently reduced by {approx}75% the 11-dTxB2 production in all individuals. In addition, the level of 11-dTxB2 might be influenced by genetic characteristics. Keeping in mind the small numbers of individuals studied and the multiplicity of the analysis that might affect the statistic power, our current findings should be interpreted with precaution and will await further demonstration on larger studies.


*    Acknowledgments
 
This project has been supported by SAF2003-00840 (MCYT and FEDER). The authors thank Dr Iniesta for helpful suggestions and A. Miñano for technical assistance. R. González-Conejero and J. Corral are contratados de Investigación Ramón y Cajal, Universidad de Murcia.

Received August 9, 2004; revision received October 5, 2004; accepted October 28, 2004.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Collaborative meta-analysis of randomised trials of antiplatelet therapy for prevention of death, myocardial infarction, and stroke in high risk patients. Antithrombotic Trialists’ Collaboration. BMJ. 2002; 324: 71–86.[Abstract/Free Full Text]

2. Patrono C. Aspirin resistance: definition, mechanisms and clinical read-outs. J Thromb Haemost. 2003; 1: 1710–1713.[CrossRef][Medline] [Order article via Infotrieve]

3. Bhatt DL, Topol EJ. Scientific and therapeutic advances in antiplatelet therapy. Nat Rev Drug Discov. 2003; 2: 15–28.[CrossRef][Medline] [Order article via Infotrieve]

4. Gum PA, Kottke-Marchant K, Poggio ED, Gurm H, Welsh PA, Brooks L, Sapp SK, Topol EJ. Profile and prevalence of aspirin resistance in patients with cardiovascular disease. Am J Cardiol. 2001; 88: 230–235.[CrossRef][Medline] [Order article via Infotrieve]

5. George JN, Shattil SJ. The clinical importance of acquired abnormalities of platelet function. N Engl J Med. 1991; 324: 27–39.[Medline] [Order article via Infotrieve]

6. Nicholson NS, Panzer-Knodle SG, Haas NF, Taite BB, Szalony JA, Page JD, Feigen LP, Lansky DM, Salyers AK. Assessment of platelet function assays. Am Heart J. 1998; 135: S170–S178.[CrossRef][Medline] [Order article via Infotrieve]

7. Eikelboom JW, Hirsh J, Weitz JI, Johnston M, Yi Q, Yusuf S. Aspirin-resistant thromboxane biosynthesis and the risk of myocardial infarction, stroke, or cardiovascular death in patients at high risk for cardiovascular events. Circulation. 2002; 105: 1650–1655.[Abstract/Free Full Text]

8. Halushka MK, Halushka PV. Why are some individuals resistant to the cardioprotective effects of aspirin? Could it be thromboxane A2? Circulation. 2002; 105: 1620–1622.[Free Full Text]

9. Favaloro EJ. Clinical application of the PFA-100. Curr Opin Hematol. 2002; 9: 407–415.[CrossRef][Medline] [Order article via Infotrieve]

10. Chakroun T, Gerotziafas G, Robert F, Lecrubier C, Samama MM, Hatmi M, Elalamy I. In vitro aspirin resistance detected by PFA-100 closure time: pivotal role of plasma von Willebrand factor. Br J Haematol. 2004; 124: 80–85.[CrossRef][Medline] [Order article via Infotrieve]

11. Grundmann K, Jaschonek K, Kleine B, Dichgans J, Topka H. Aspirin non-responder status in patients with recurrent cerebral ischemic attacks. J Neurol. 2003; 250: 63–66.[CrossRef][Medline] [Order article via Infotrieve]

12. Smith JB. Forum on aspirin. J Thromb Haemost. 2004; 2: 335–336.[CrossRef][Medline] [Order article via Infotrieve]

13. Cambria-Kiely JA, Gandhi PJ. Aspirin resistance and genetic polymorphisms. J Thromb Thrombolysis. 2002; 14: 51–58.[CrossRef][Medline] [Order article via Infotrieve]

14. Halushka MK, Walker LP, Halushka PV. Genetic variation in cyclooxygenase 1: effects on response to aspirin. Clin Pharmacol Ther. 2003; 73: 122–130.[CrossRef][Medline] [Order article via Infotrieve]

15. Papafili A, Hill MR, Brull DJ, McAnulty RJ, Marshall RP, Humphries SE, Laurent GJ. Common promoter variant in cyclooxygenase-2 represses gene expression: evidence of role in acute-phase inflammatory response. Arterioscler Thromb Vasc Biol. 2002; 22: 1631–1636.[Abstract/Free Full Text]

16. Macchi L, Christiaens L, Brabant S, Sorel N, Ragot S, Allal J, Mauco G, Brizard A. Resistance in vitro to low-dose aspirin is associated with platelet PlA1 (GP IIIa) polymorphism but not with C807T(GP Ia/IIa) and C-5T Kozak (GP Ibalpha) polymorphisms. J Am Coll Cardiol. 2003; 42: 1115–1119.[Abstract/Free Full Text]

17. Undas A, Sydor WJ, Brummel K, Musial J, Mann KG, Szczeklik A. Aspirin alters the cardioprotective effects of the factor XIII Val34Leu polymorphism. Circulation. 2003; 107: 17–20.[Abstract/Free Full Text]

18. Capone ML, Tacconelli S, Sciulli MG, Grana M, Ricciotti E, Minuz P, Di Gregorio P, Merciaro G, Patrono C, Patrignani P. Clinical pharmacology of platelet, monocyte, and vascular cyclooxygenase inhibition by naproxen and low-dose aspirin in healthy subjects. Circulation. 2004; 109: 1468–1471.[Abstract/Free Full Text]

19. O’Kane PD, Queen LR, Ji Y, Reebye V, Stratton P, Jackson G, Ferro A. Aspirin modifies nitric oxide synthase activity in platelets: effects of acute versus chronic aspirin treatment. Cardiovasc Res. 2003; 59: 152–159.[Abstract/Free Full Text]

20. Corral J, Gonzalez-Conejero R, Rivera J, Ortuno F, Aparicio P, Vicente V. Role of the 807 C/T polymorphism of the alpha2 gene in platelet GP Ia collagen receptor expression and function–effect in thromboembolic diseases. Thromb Haemost. 1999; 81: 951–956.[Medline] [Order article via Infotrieve]

21. Corral J, Gonzalez-Conejero R, Rivera J, Iniesta JA, Lozano ML, Vicente V. HPA-1 genotype in arterial thrombosis: role of HPA-1b polymorphism in platelet function. Blood Coagul Fibrinolysis. 1997; 8: 284–290.[Medline] [Order article via Infotrieve]

22. Corral J, Gonzalez-Conejero R, Iniesta JA, Rivera J, Martinez C, Vicente V. The FXIII Val34Leu polymorphism in venous and arterial thromboembolism. Haematologica. 2000; 85: 293–297.[Abstract/Free Full Text]

23. Atherosclerosis, Thrombosis, and Vascular Biology Italian Study Group. No evidence of association between prothrombotic gene polymorphisms and the development of acute myocardial infarction at a young age. Circulation. 2003; 107: 1117–1122.[Abstract/Free Full Text]

24. Hillarp A, Lethagen S, Mattiasson I. Aspirin resistance is not a common biochemical phenotype explained by unblocked cyclooxygenase-1 activity. J Thromb Haemost. 2003; 1: 196–197.[CrossRef][Medline] [Order article via Infotrieve]

25. Benedek IH, Joshi AS, Pieniaszek HJ, King SY, Kornhauser DM. Variability in the pharmacokinetics and pharmacodynamics of low dose aspirin in healthy male volunteers. J Clin Pharmacol. 1995; 35: 1181–1186.[Abstract]

26. Alberts MJ, Bergman DL, Molner E, Jovanovic BD, Ushiwata I, Teruya J. Antiplatelet effect of aspirin in patients with cerebrovascular disease. Stroke. 2004; 35: 175–178.[Abstract/Free Full Text]

27. Patrono C, Coller B, Dalen JE, FitzGerald GA, Fuster V, Gent M, Hirsh J, Roth G. Platelet-active drugs: the relationships among dose, effectiveness, and side effects. Chest. 2001; 119: 39S–63S.[CrossRef][Medline] [Order article via Infotrieve]

28. Hankey GJ, Eikelboom JW. Aspirin resistance. May be a cause of recurrent ischaemic vascular events in patients taking aspirin. BMJ. 2004; 328: 477–479.[Free Full Text]

29. Cipollone F, Toniato E, Martinotti S, Fazia M, Iezzi A, Cuccurullo C, Pini B, Ursi S, Vitullo G, Averna M, Arca M, Montali A, Campagna F, Ucchino S, Spigonardo F, Taddei S, Virdis A, Ciabattoni G, Notarbartolo A, Cuccurullo F, Mezzetti A. Identification of New Elements of Plaque Stability (INES) Study Group. A polymorphism in the cyclooxygenase 2 gene as an inherited protective factor against myocardial infarction and stroke. JAMA. 2004; 291: 2221–2228.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Eur Heart JHome page
W. Kuliczkowski, A. Witkowski, L. Polonski, C. Watala, K. Filipiak, A. Budaj, J. Golanski, D. Sitkiewicz, J. Pregowski, J. Gorski, et al.
Interindividual variability in the response to oral antiplatelet drugs: a position paper of the Working Group on antiplatelet drugs resistance appointed by the Section of Cardiovascular Interventions of the Polish Cardiac Society, endorsed by the Working Group on Thrombosis of the European Society of Cardiology
Eur. Heart J., February 2, 2009; 30(4): 426 - 435.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
O. M. Akay, Z. Canturk, E. Akin, C. Bal, and Z. Gulbas
Aspirin-Resistance Frequency: A Prospective Study in 280 Healthy Turkish Volunteers
Clinical and Applied Thrombosis/Hemostasis, February 1, 2009; 15(1): 98 - 102.
[Abstract] [PDF]


Home page
Clin. Chem.Home page
B. S. Karon, A. Wockenfus, R. Scott, S. J. Hartman, J. P. McConnell, P. J. Santrach, and A. S. Jaffe
Aspirin Responsiveness in Healthy Volunteers Measured with Multiple Assay Platforms
Clin. Chem., June 1, 2008; 54(6): 1060 - 1065.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. Y. Gasparyan, T. Watson, and G. Y.H. Lip
The Role of Aspirin in Cardiovascular Prevention: Implications of Aspirin Resistance
J. Am. Coll. Cardiol., May 13, 2008; 51(19): 1829 - 1843.
[Abstract] [Full Text] [PDF]


Home page
J CARDIOVASC PHARMACOL THERHome page
S. Tseeng and R. Arora
Aspirin Resistance: Biological and Clinical Implications
Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2008; 13(1): 5 - 12.
[Abstract] [PDF]


Home page
Eur Heart JHome page
M. Lordkipanidze, C. Pharand, E. Schampaert, J. Turgeon, D. A. Palisaitis, and J. G. Diodati
A comparison of six major platelet function tests to determine the prevalence of aspirin resistance in patients with stable coronary artery disease
Eur. Heart J., July 2, 2007; 28(14): 1702 - 1708.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
M. Cattaneo
Laboratory detection of 'aspirin resistance': what test should we use (if any)?
Eur. Heart J., July 2, 2007; 28(14): 1673 - 1675.
[Full Text] [PDF]


Home page
CirculationHome page
P. A. Gurbel, K. P. Bliden, J. DiChiara, J. Newcomer, W. Weng, N. K. Neerchal, T. Gesheff, S. K. Chaganti, A. Etherington, and U. S. Tantry
Evaluation of Dose-Related Effects of Aspirin on Platelet Function: Results From the Aspirin-Induced Platelet Effect (ASPECT) Study
Circulation, June 26, 2007; 115(25): 3156 - 3164.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. Faraday, L. R. Yanek, R. Mathias, J. E. Herrera-Galeano, D. Vaidya, T. F. Moy, M. D. Fallin, A. F. Wilson, P. F. Bray, L. C. Becker, et al.
Heritability of Platelet Responsiveness to Aspirin in Activation Pathways Directly and Indirectly Related to Cyclooxygenase-1
Circulation, May 15, 2007; 115(19): 2490 - 2496.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Undas, K. E. Brummel-Ziedins, and K. G. Mann
Antithrombotic properties of aspirin and resistance to aspirin: beyond strictly antiplatelet actions
Blood, March 15, 2007; 109(6): 2285 - 2292.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
36/2/276    most recent
01.STR.0000151362.65339.f9v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gonzalez-Conejero, R.
Right arrow Articles by Vicente, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gonzalez-Conejero, R.
Right arrow Articles by Vicente, V.
Related Collections
Right arrow Aggregation
Right arrow Platelet function inhibitors
Right arrow Platelets
Right arrow Other Research