Donate Help Contact The AHA Sign In Home
American Heart Association
Stroke
Search: search_blue_button Advanced Search
Stroke. 2005;36:731-736
Published online before print February 24, 2005, doi: 10.1161/01.STR.0000157587.59821.87
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
36/4/731    most recent
01.STR.0000157587.59821.87v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lõhmussaar, E.
Right arrow Articles by Dichgans, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lõhmussaar, E.
Right arrow Articles by Dichgans, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ETHYLENEDIAMINE TETRAACETIC ACID
Medline Plus Health Information
*Stroke
Related Collections
Right arrow Genetics of Stroke

(Stroke. 2005;36:731.)
© 2005 American Heart Association, Inc.


Original Contributions

ALOX5AP Gene and the PDE4D Gene in a Central European Population of Stroke Patients

Elin Lõhmussaar, MSc; Andreas Gschwendtner, MD; Jakob C. Mueller, PhD; Tõnis Org, MSc; Erich Wichmann, PhD; Gerhard Hamann, MD; Thomas Meitinger, MD, PhD Martin Dichgans, MD

From the Institutes of Human Genetics (E.L., J.C.M., T.O., T.M.) and Epidemiology (E.W.), GSF-National Research Institute for Environment and Health, Neuherberg, Germany; the Institute of Molecular and Cell Biology (E.L., T.O.), University of Tartu, Estonian Biocenter, Estonia; the Department of Neurology (A.G., G.H., M.D.), Klinikum of Großhadern, Munich, Germany; and the Institute of Human Genetics (T.M.), Technical University Munich, Germany.

Correspondence to Dr Martin Dichgans, Department of Neurology, Klinikum Großhadern Marchioninistr. 15 D-81377 München Germany. E-mail martin.dichgans{at}med.uni-muenchen.de


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowSubjects and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background and Purpose— Recent evidence has implicated the genes for 5-lipoxygenase activating protein (ALOX5AP) and phosphodiesterase 4D (PDE4D) as susceptibility genes for stroke in the Icelandic population. The aim of the present study was to explore the role of these genes in a central European population of stroke patients.

Methods— A total of 639 consecutive stroke patients and 736 unrelated population-based controls that had been matched for age and sex were examined using a case-control design. Twenty-two single-nucleotide polymorphisms (SNPs) covering ALOX5AP were genotyped. For PDE4D, microsatellite AC008818-1 and 12 SNPs, which tag all common haplotypes in previously identified linkage disequilibrium (LD) blocks, were analyzed.

Results— A nominally significant association with stroke was observed with several SNPs from ALOX5AP, including SNP SG13S114, which had been part of the Icelandic at-risk haplotype. Associations were stronger in males than in females, with SG13S114 (odds ratio, 1.24; 95% CI, 1.04 to 1.55; P=0.017) and SG13S100 (odds ratio, 1.26; 95% CI 1.03 to 1.54; P=0.024) showing the strongest associations. No significant associations were detected with single markers and haplotypes in PDE4D. The frequencies of single-marker alleles and haplotypes differed largely from those in the Icelandic population.

Conclusions— The present study suggests that sequence variants in the ALOX5AP gene are significantly associated with stroke, particularly in males. Variants in the PDE4D gene are not a major risk factor for stroke in individuals from central Europe. Population differences in allele and haplotype frequencies as well as LD structure may contribute to the observed differences between populations.


Key Words: genetics • stroke


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowSubjects and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Recently, the 5-lipoxygenase activating protein gene (ALOX5AP) on chromosome 13q and the phosphodiesterase 4D gene (PDE4D) on chromosome 5q have been reported to confer risk of stroke independently of conventional risk factors.1–3 The candidacy of these genes was identified through genome-wide scans and subsequent case-control association studies in individuals from Iceland. Both genes have been implicated in atherosclerosis.

ALOX5AP encodes 5-lipoxygenase-activating protein, which is required for the synthesis of leukotrienes.4 Leukotrienes are secreted by various types of inflammatory cells that cluster at the injured sites in blood vessels and are implicated in the progression of atherosclerosis.5–7 In the study from DeCode, a single ALOX5AP haplotype (termed HapA) was found to double the risk of myocardial infarction (MI) and stroke in patients from Iceland. Another haplotype (termed HapB) was associated with MI in individuals from the United Kingdom, but patients with stroke were not investigated.3

PDE4D encodes phosphodiesterase 4D, which is a member of a large super-family of cyclic nucleotide phosphodiesterases. Phosphodiesterase 4D degrades second messenger cAMP, which is a key signal transduction molecule in different cell types, including inflammatory, vascular endothelial, and smooth muscle cells.8–10 Low levels of cAMP enhance cell migration and proliferation,11 processes that are proatherogenic. Gretarsdottir et al2 found that specific single markers and haplotypes at PDE4D are associated with carotid and cardiogenic stroke but not with other stroke subtypes.

Although of great potential importance, these findings need to be replicated in other populations. Therefore, we set up to evaluate the candidacy of ALOX5AP and PDE4D as susceptibility genes for stroke in a large population of stroke patients and matched controls from central Europe using single-marker and haplotype association tests and a case-control design.


*    Subjects and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Subjects and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Study Sample
The study population consisted of 639 patients (mean age 65±18.2 years; 403 men) consecutively recruited from a single stroke unit (Department of Neurology, Klinikum Großhadern, University of Munich, Germany) that serves as a major referral center in the area covering a population of {approx}4 million people. Thus, for practical purposes, these patients may be considered unrelated. All patients underwent computed tomography of the head for initial imaging and an ECG immediately after hospital admission. Duplex sonography of the carotid arteries was performed in all patients. A total of 492 (77%) patients received an MRI including diffusion-weighted images, which was usually performed within 3 days after admission. Magnetic resonance angiography was obtained in 251 (39%) cases. Transcranial Doppler sonography and transthoracal echocardiography were done in >90% and 60% of the patients, respectively. Holter monitoring and transesophageal echocardiography were done if appropriate.

Ischemic stroke was diagnosed in 601 patients and was further classified into stroke subtypes using the Trial of Org 10172 in Acute Stroke Treatment (TOAST) classification.12 A total of 186 patients had large vessel disease (or "carotid stroke," as referred to by Gretardsdottir et al2), 143 had cardioembolic stroke (or "cardiogenic stroke"2), and 86 had lacunar stroke. In 45 cases, stroke with other determined etiology was diagnosed, and in 141, the etiology remained unclear despite diagnostic efforts or competing etiologies were found. The remaining patients (n=38) had a hemorrhagic stroke.

The control group consisted of 736 unrelated individuals (mean age 62±11.7 years; 447 men), who were selected from the KORAS2000 study, a community-based epidemiological project near Munich. Controls were sampled to match stroke patients for age and gender. Informed consent was obtained from all individuals (or relatives or legal guardians). Genomic DNA was extracted from EDTA blood using standard protocols. The study was approved by the local ethics committee.

Marker Selection and Genotyping
The nomenclature of markers used in the original studies was adopted and maintained throughout the current study.2,3 For ALOX5AP, we selected all 22 single-nucleotide polymorphisms (SNPs) that had been used for haplotype analysis in the original study by the DeCode group.3 They cover the entire ALOX5AP gene by a mean distance of 1.9 kb between SNPs. For PDE4D, we selected 2 SNPs (SNP45 and SNP41) and 1 microsatellite marker (AC008818-1), which had shown the most significant association with stroke in the original study.2 We further identified an optimal set of haplotype tagging SNPs (htSNPs) that distinguished 95% of all chromosomes within linkage disequilibrium (LD) blocks "B" and "C" using a nested algorithm implemented in the program SNPtagger.2,13 Eight htSNPs were from block B (SNP73, SNP69, SNP67, SNP57, SNP49, SNP48, SNP45, and SNP41) and 4 htSNPs from block C (SNP34, SNP30, SNP20, and SNP6).2 Genotyping of SNPs was achieved by primer extension of multiplex polymerase chain reaction products with detection of allele-specific extension products by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF; Sequenom) mass spectroscopy. Microsatellite AC008818-1 was genotyped using fluorescently labeled oligonucleotide probes by ABI 3730 sequencer (Applera Corporation). Amplification of AC008818-1 marker alleles was obtained by using the sense primer 5' TGCTTGGTGAAGGAATAGCC 3' and antisense primer 5' GAGCCTGGGTTCTCAGGAAT 3'. Marker sequences were obtained from the Genome database, and SNPs were selected from the initial publications.2,3 There were no deviations from Hardy-Weinberg equilibrium (tested by a {chi}2 test), and all markers were genotyped with a high call rate (average 99%).

Statistical Methods
Allele and genotype frequencies were calculated for each locus and tested for Hardy-Weinberg equilibrium. Pairwise LD values were plotted using the software package Haploview (Barrett; Whitehead Institute, 2003). The program PHASE version 2.0 was used for haplotype frequency estimation, which uses a Bayesian method accounting for the evolutionary relationship of estimated haplotypes.14

Single-marker associations between phenotype and genotype were tested by logistic regression analyses (STATA statistical software package). The association of haplotypes was inferred by the haplotype trend regression method proposed by Zaykin et al.15 Individuals’ haplotype probabilities estimated by the phase estimation procedure are regressed against the phenotype state. We tested 2-, 3-, 4- and all marker haplotypes from adjacent SNPs in a sliding-window fashion, as well as using all different 2-marker combinations.

Markers and haplotypes significantly associated in the original studies were evaluated by confirmatory testing using uncorrected P values. For markers or haplotypes not significantly associated in the original studies, experiment-wise significance levels were evaluated by a permutation procedure, which corrects for the number of tests performed in a given marker set.

The power of our case-control sample to detect a similarly sized effect as in the original studies was determined by using the reported relative risks and risk allele frequencies2,3 at a 5% type I error rate under a multiplicative model.16


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowSubjects and Methods
*Results
down arrowDiscussion
down arrowReferences
 
ALOX5AP
We first performed single-marker association tests with the 4 SNPs (SG13S25, SG13S114, SG13S89, and SG13S32) constituting HapA (ie, the haplotype that was associated with stroke and MI in patients from Iceland).3 As shown in Table 1, the T allele of marker SG13S114 was more frequent in our stroke cases compared with controls (P=0.025). This effect was most significant in males and not significant in women. Subgroup analysis for stroke subtypes revealed no significant association with stroke subtypes (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Single-Marker Allelic Association in the ALOX5AP Gene With Markers Constituting HapA Reported Previously to be Associated With Stroke

Next, we looked at the HapA haplotype. As shown in Table 2, there was no significant association with HapA in our continental population of stroke patients. Also, association tests with males or females separately and with different stroke subtypes revealed no significant associations. Contrasting with the Icelandic study, HapA occurred more often in controls than in cases. Also, the frequency in controls was considerably higher than in the Icelandic population (Table 2). We also looked at the HapB haplotype, which was associated with MI in individuals from the United Kingdom.3 However, no significant association was found with the stroke phenotype in our sample (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Association of HapA (ALOX5AP) to Stroke

Because we could not replicate associations with HapA, we expected that there might be other unidentified haplotypes in ALOX5AP that confer risk to stroke in our population. Therefore, we performed different haplotype combination tests constructed from 2, 4, and all SNPs. Several haplotypes were significantly associated with stroke (minimum P value=0.004; supplemental Table I, available online at http://www.strokeaha.org; data not shown). However, after correction for multiple testing, associations were no longer significant. Single-marker analysis with the remaining SNPs (not included in HapA) revealed nominally significant associations between several markers (SG13S100, SG13S34, SG13S86, and SG13S96) and overall stroke (Table II, available online at http://www.strokeaha.org). However, after correction for multiple testing, associations were no longer significant.

To check for possible differences in LD structure between our German and the Icelandic sample, we determined the LD structure and haplotype diversity of ALOX5AP in our population (Table I). Most SNPs were in strong LD, and the LD block structure was similar to that in the Icelandic population (Figure 1).3



View larger version (60K):
[in this window]
[in a new window]
 
Figure 1. Pairwise LD between SNPs in the ALOX5AP gene region. A color-coded scale for D' (a measure of LD strength) is provided.

PDE4D
We started by performing single-marker association tests with SNP45, SNP41, and AC008818-1, which had shown the most significant associations with the combined carotid and cardiogenic stroke subtypes in the Icelandic population.2 No association was found with the overall population of stroke patients, the combined phenotype, or any of the stroke subtypes (Table 3 and data not shown). Again, the frequency of the original at-risk alleles was considerably higher in our controls than in the Icelandic control sample.2


View this table:
[in this window]
[in a new window]
 
TABLE 3. Single-Marker Allelic Association in the PDE4D Gene With Markers Reported Previously to be Associated With Combined Carotid and Cardiogenic Stroke

Next, we constructed haplotypes using the same combination of markers (AC008818-1 and SNP45), which had shown significant association with the combined carotid and cardiogenic stroke phenotypes in the Icelandic population. However, no associations were found (Table 4). In addition, we looked at all possible haplotypes constructed from 2, 3, 4, or all SNPs from blocks B and C using the full set of htSNPs. Again, no significant associations were found after correction for multiple testing (Table III, available online at http://www.strokeaha.org; data not shown). Single-marker analysis with the remaining markers (all but SNP45, SNP41, and AC008818-1) revealed nominally significant associations between SNP73 and cardiogenic stroke and between SNP57 and carotid stroke and the combined carotid and cardiogenic stroke subtype (Table IV, available online at http://www.strokeaha.org; data not shown). However, after correction for multiple comparisons, these associations were not significant.


View this table:
[in this window]
[in a new window]
 
TABLE 4. Association of PDE4D Haplotypes Reported Previously to be Associated With Combined Carotid and Cardiogenic Stroke


View this table:
[in this window]
[in a new window]
 
TABLE I. Association of ALOX5AP Haplotypes With a Population Frequency >2%


View this table:
[in this window]
[in a new window]
 
TABLE II. Single Marker Allelic Association in the ALOX5AP Gene With Markers Not Contained in HapA


View this table:
[in this window]
[in a new window]
 
TABLE III. Association of PDE4D Haplotypes Within Blocks B and C With a Population Frequency >2%


View this table:
[in this window]
[in a new window]
 
TABLE IV. Single Marker Allelic Association in the PDE4D Gene With Haplotype Tagging SNP

To check for possible differences in LD structure between our German and the Icelandic sample, we determined the LD structure and haplotype diversity of PDE4D in our population (Table III). The LD between SNPs was less pronounced than in the Icelandic population, and the LD block structure slightly differed from that reported by DeCode (Figure 2).2



View larger version (86K):
[in this window]
[in a new window]
 
Figure 2. Pairwise LD between SNPs in the PDE4D gene region. A color-coded scale for D' (a measure of LD strength) is provided.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowSubjects and Methods
up arrowResults
*Discussion
down arrowReferences
 
In this study, we applied a 2-step replication approach. We first examined the most significant single markers and haplotypes that were associated with stroke in the Icelandic population. Analysis was then extended to additional markers and haplotypes.

We found no association with the Icelandic at-risk haplotype (HapA) of ALOX5AP. However, we found a significant association with 1 of the single markers (SG13S114) constituting this haplotype. Also, association between SG13S114 and stroke was stronger in males than in females, which is similar to the findings from Iceland. Finally, several other markers not contained in HapA showed a nominally significant association with stroke. Together, these findings suggest a weak but significant association between sequence variants in ALOX5AP and stroke in the present sample from central Europe.

The observed lack of association with HapA may relate in part to population differences in allele and haplotype frequencies. In support of this, the frequency of HapA was much higher in our continental sample of control individuals than in the Icelandic controls. Another explanation are different patterns of association of the high-risk allele with marker alleles and haplotypes.17–19 In fact, in the original study, haplotypes associated with MI were found to differ between the Icelandic and British population.3 However, interestingly, all haplotypes that had shown significant association contained either the T allele of SG13S114 or the A allele of SG13S100, both of which showed nominally significant P values in the current study. Further studies are needed to identify the causative sequence variant or variants in ALOX5AP.

The initial study provided data on an overall sample of stroke patients without detailed specification of stroke phenotypes. In the current study, we also looked at stroke subtypes but found no association with particular stroke etiologies. This observation suggests that the associations in the overall group are not related to associations with a single stroke subtype. Future studies with larger subgroups may specify the role of ALOX5AP in different stroke subtypes.

In the current study, no significant association was found between single markers or specific haplotypes of PDE4D and stroke. This applies to all subgroups including carotid stroke, cardiogenic stroke, and the combined carotid and cardiogenic stroke subtypes, which had shown the strongest associations in the Icelandic population. Assuming a multiplicative model and the relative risks of single markers and haplotypes reported by DeCode, the power of our sample to detect the same associations should be >99% (data not shown). Also, phenotyping of our patients was particularly careful because all cases were recruited from a single unit specialized in stroke care and because diagnostic classification was based on extensive investigations with a high proportion of Doppler sonography, ECG, and MRI performed. Thus, we conclude that the PDE4D gene is probably not a major risk factor for overall stroke or stroke subtypes in our population.

Like the data from DeCode, our findings need to be interpreted cautiously. Our analysis of the PDE4D gene was limited to single markers and htSNPs from the 5' region of the gene. Thus, we cannot exclude the possibility of association with sequence variants in other regions of the PDE4D gene. However, we consider this possibility unlikely because most markers that had shown significant associations in the Icelandic sample were located in the 5' region of the gene.2 In fact, the most significant associations had been on the very 5' end of PDE4D, which was covered in the current study. Another possible limitation is the low number of markers used to characterize PDE4D. Our set of htSNPs markers was designed to distinguish 95% of all haplotypes reported by DeCode. However, we found that the LD between single markers was less pronounced in our population, and the LD block structure differed slightly from that reported from Iceland. Thus, our set of htSNPs may have covered too little of the genetic variability in PDE4D in our population. On the other hand, the higher LD reported by DeCode might well reflect a founder effect in the Icelandic population, which, as a relatively isolated population, has a restricted gene pool. In fact, a founder effect in Iceland could explain the initial association and the current lack of replication in an independent population.

In conclusion, the present study suggests that sequence variants in ALOX5AP are in fact a significant risk factor for stroke, particularly in males. In contrast, the PDE4D gene is no major risk factor for stroke in the central European population. Our findings emphasize differences in allele and haplotype frequencies as well as LD structure between populations which may account in part for the different association findings between studies. UpUpUpUp


*    Acknowledgments
 
This study was supported by the Deutsche Forschungsgemeinschaft (KFO 113), the German Federal Ministry of Education, Science, Research, and Technology, the Estonian Science Foundation (grant no. 4578), and the State of Bavaria. The authors thank all subjects who participated in this study, T. Illig for selecting the control sample, and J. Benson for critically reading this manuscript.

Received October 22, 2004; revision received November 29, 2004; accepted December 13, 2004.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowSubjects and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Gretarsdottir S, Sveinbjornsdottir S, Jonsson HH, Jakobsson F, Einarsdottir E, Agnarsson U, Shkolny D, Einarsson G, Gudjonsdottir HM, Valdimarsson EM, Einarsson OB, Thorgeirsson G, Hadzic R, Jonsdottir S, Reynisdottir ST, Bjarnadottir SM, Gudmundsdottir T, Gudlaugsdottir GJ, Gill R, Lindpaintner K, Sainz J, Hannesson HH, Sigurdsson GT, Frigge ML, Kong A, Gudnason V, Stefansson K, Gulcher JR. Localization of a susceptibility gene for common forms of stroke to 5q12. Am J Hum Genet. 2002; 70: 593–603.[CrossRef][Medline] [Order article via Infotrieve]

2. Gretarsdottir S, Thorleifsson G, Reynisdottir ST, Manolescu A, Jonsdottir S, Jonsdottir T, Gudmundsdottir T, Bjarnadottir SM, Einarsson OB, Gudjonsdottir HM, Hawkins M, Gudmundsson G, Gudmundsdottir H, Andrason H, Gudmundsdottir AS, Sigurdardottir M, Chou TT, Nahmias J, Goss S, Sveinbjornsdottir S, Valdimarsson EM, Jakobsson F, Agnarsson U, Gudnason V, Thorgeirsson G, Fingerle J, Gurney M, Gudbjartsson D, Frigge ML, Kong A, Stefansson K, Gulcher JR. The gene encoding phosphodiesterase 4d confers risk of ischemic stroke. Nat Genet. 2003; 35: 131–138.[CrossRef][Medline] [Order article via Infotrieve]

3. Helgadottir A, Manolescu A, Thorleifsson G, Gretarsdottir S, Jonsdottir H, Thorsteinsdottir U, Samani NJ, Gudmundsson G, Grant SF, Thorgeirsson G, Sveinbjornsdottir S, Valdimarsson EM, Matthiasson SE, Johannsson H, Gudmundsdottir O, Gurney ME, Sainz J, Thorhallsdottir M, Andresdottir M, Frigge ML, Topol EJ, Kong A, Gudnason V, Hakonarson H, Gulcher JR, Stefansson K. The gene encoding 5-lipoxygenase activating protein confers risk of myocardial infarction and stroke. Nat Genet. 2004; 36: 233–239.[CrossRef][Medline] [Order article via Infotrieve]

4. Dixon WT, Demetrick DJ, Ohyama K, Sikora LK, Jerry LM. Biosynthesis, glycosylation and intracellular processing of the neuroglandular antigen, a human melanoma-associated antigen. Cancer Res. 1990; 50: 4557–4565.[Abstract/Free Full Text]

5. Samuelsson B. Leukotrienes: mediators of immediate hypersensitivity reactions and inflammation. Science. 1983; 220: 568–575.[Abstract/Free Full Text]

6. Mehrabian M, Allayee H, Wong J, Shi W, Wang XP, Shaposhnik Z, Funk CD, Lusis AJ, Shih W. Identification of 5-lipoxygenase as a major gene contributing to atherosclerosis susceptibility in mice. Circ Res. 2002; 91: 120–126.[Abstract/Free Full Text]

7. Spanbroek R, Grabner R, Lotzer K, Hildner M, Urbach A, Ruhling K, Moos MP, Kaiser B, Cohnert TU, Wahlers T, Zieske A, Plenz G, Robenek H, Salbach P, Kuhn H, Radmark O, Samuelsson B, Habenicht AJ. Expanding expression of the 5-lipoxygenase pathway within the arterial wall during human atherogenesis. Proc Natl Acad Sci U S A. 2003; 100: 1238–1243.[Abstract/Free Full Text]

8. Baillie G, MacKenzie SJ, Houslay MD. Phorbol 12-myristate 13-acetate triggers the protein kinase a-mediated phosphorylation and activation of the pde4d5 cAMP phosphodiesterase in human aortic smooth muscle cells through a route involving extracellular signal regulated kinase (ERK). Mol Pharmacol. 2001; 60: 1100–1111.[Abstract/Free Full Text]

9. Liu H, Palmer D, Jimmo SL, Tilley DG, Dunkerley HA, Pang SC, Maurice DH. Expression of phosphodiesterase 4d (PDE4D) is regulated by both the cyclic AMP-dependent protein kinase and mitogen-activated protein kinase signaling pathways. A potential mechanism allowing for the coordinated regulation of pde4d activity and expression in cells. J Biol Chem. 2000; 275: 26615–26624.[Abstract/Free Full Text]

10. Landells LJ, Szilagy CM, Jones NA, Banner KH, Allen JM, Doherty A, O’Connor BJ, Spina D, Page CP. Identification and quantification of phosphodiesterase 4 subtypes in cd4 and cd8 lymphocytes from healthy and asthmatic subjects. Br J Pharmacol. 2001; 133: 722–729.[CrossRef][Medline] [Order article via Infotrieve]

11. Indolfi C, Avvedimento EV, Di Lorenzo E, Esposito G, Rapacciuolo A, Giuliano P, Grieco D, Cavuto L, Stingone AM, Ciullo I, Condorelli G, Chiariello M. Activation of cAMP-PKA signaling in vivo inhibits smooth muscle cell proliferation induced by vascular injury. Nat Med. 1997; 3: 775–779.[CrossRef][Medline] [Order article via Infotrieve]

12. Adams HP Jr, Bendixen BH, Kappelle LJ, Biller J, Love BB, Gordon DL, Marsh EE III. Classification of subtype of acute ischemic stroke. Definitions for use in a multicenter clinical trial. TOAST. Trial of Org 10172 in Acute Stroke Treatment. Stroke. 1993; 24: 35–41.[Abstract/Free Full Text]

13. Ke X, Cardon LR. Efficient selective screening of haplotype tag snps. Bioinformatics. 2003; 19: 287–288.[Abstract/Free Full Text]

14. Stephens M, Smith NJ, Donnelly P. A new statistical method for haplotype reconstruction from population data. Am J Hum Genet. 2001; 68: 978–989.[CrossRef][Medline] [Order article via Infotrieve]

15. Zaykin DV, Westfall PH, Young SS, Karnoub MA, Wagner MJ, Ehm MG. Testing association of statistically inferred haplotypes with discrete and continuous traits in samples of unrelated individuals. Hum Hered. 2002; 53: 79–91.[Medline] [Order article via Infotrieve]

16. Freidlin B, Zheng G, Li Z, Gastwirth JL. Trend tests for case-control studies of genetic markers: power, sample size and robustness. Hum Hered. 2002; 53: 146–152.[CrossRef][Medline] [Order article via Infotrieve]

17. Pritchard JK, Cox NJ. The allelic architecture of human disease genes: common disease-common variant... or not? Hum Mol Genet. 2002; 11: 2417–2423.[Abstract/Free Full Text]

18. Clark AG. Finding genes underlying risk of complex disease by linkage disequilibrium mapping. Curr Opin Genet Dev. 2003; 13: 296–302.[CrossRef][Medline] [Order article via Infotrieve]

19. Botstein D, Risch N. Discovering genotypes underlying human phenotypes: past successes for mendelian disease, future approaches for complex disease. Nat Genet. 2003; 33 (suppl): 228–237.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
StrokeHome page
T. Matsushita, M. Kubo, K. Yonemoto, T. Ninomiya, K. Ashikawa, B. Liang, J. Hata, Y. Doi, T. Kitazono, S. Ibayashi, et al.
Lack of Association Between Variations of PDE4D and Ischemic Stroke in the Japanese Population
Stroke, April 1, 2009; 40(4): 1245 - 1251.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
E. Zintzaras, P. Rodopoulou, and N. Sakellaridis
Variants of the Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP) Gene and Risk of Stroke: A HuGE Gene-Disease Association Review and Meta-Analysis
Am. J. Epidemiol., March 1, 2009; 169(5): 523 - 532.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
T. Freilinger, S. Bevan, S. Ripke, A. Gschwendtner, P. Lichtner, B. Muller-Myhsok, H. -E. Wichmann, H. S. Markus, T. Meitinger, and M. Dichgans
Genetic Variation in the Lymphotoxin-Alpha Pathway and the Risk of Ischemic Stroke in European Populations
Stroke, March 1, 2009; 40(3): 970 - 972.
[Abstract] [Full Text] [PDF]


Home page
Lab MedHome page
M.-S. Hsieh, S.-C. Yu, W.-T. Chung, Y.-M. Hsueh, F.-C. Chen, W.-T. Chiu, and H.-M. Lee
Phosphodiesterase 4D (PDE4D) Gene Variants and Risk of Ischemic Stroke in the Taiwanese Population
Lab Med, February 1, 2009; 40(2): 87 - 90.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Ye, Y. Lin, J. R. Perez-Polo, B. F. Uretsky, Z. Ye, B. C. Tieu, and Y. Birnbaum
Phosphorylation of 5-Lipoxygenase at Ser523 by Protein Kinase A Determines Whether Pioglitazone and Atorvastatin Induce Proinflammatory Leukotriene B4 or Anti-Inflammatory 15-Epi-Lipoxin A4 Production
J. Immunol., September 1, 2008; 181(5): 3515 - 3523.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
R. A. Gubitosi-Klug, R. Talahalli, Y. Du, J. L. Nadler, and T. S. Kern
5-Lipoxygenase, but Not 12/15-Lipoxygenase, Contributes to Degeneration of Retinal Capillaries in a Mouse Model of Diabetic Retinopathy
Diabetes, May 1, 2008; 57(5): 1387 - 1393.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
D. T. Miller, P. M. Ridker, P. Libby, and D. J. Kwiatkowski
Atherosclerosis: The Path From Genomics to Therapeutics
J. Am. Coll. Cardiol., April 17, 2007; 49(15): 1589 - 1599.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
W. Lalouschek, G. Endler, M. Schillinger, K. Hsieh, W. Lang, S. Cheng, P. Bauer, O. Wagner, and C. Mannhalter
Candidate Genetic Risk Factors of Stroke: Results of a Multilocus Genotyping Assay
Clin. Chem., April 1, 2007; 53(4): 600 - 605.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
A. K Luo, B. K Jefferson, M. J Garcia, G. S Ginsburg, and E. J Topol
Challenges in the phenotypic characterisation of patients in genetic studies of coronary artery disease
J. Med. Genet., March 1, 2007; 44(3): 161 - 165.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
M. Dichgans and R. A. Hegele
Update on the Genetics of Stroke and Cerebrovascular Disease 2006
Stroke, February 1, 2007; 38(2): 216 - 218.
[Full Text] [PDF]


Home page
StrokeHome page
K. van Leyen, H. Y. Kim, S.-R. Lee, G. Jin, K. Arai, and E. H. Lo
Baicalein and 12/15-Lipoxygenase in the Ischemic Brain
Stroke, December 1, 2006; 37(12): 3014 - 3018.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
C. Kamm, F. Asmus, J. Mueller, P. Mayer, M. Sharma, U. J. Muller, S. Beckert, R. Ehling, T. Illig, H. E. Wichmann, et al.
Strong genetic evidence for association of TOR1A/TOR1B with idiopathic dystonia
Neurology, November 28, 2006; 67(10): 1857 - 1859.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. J. Topol, J. Smith, E. F. Plow, and Q. K. Wang
Genetic susceptibility to myocardial infarction and coronary artery disease
Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R117 - R123.
[Abstract] [Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
J M Staton, M S Sayer, G J Hankey, J Attia, A Thakkinstian, Q Yi, V J Cole, R Baker, and J W Eikelboom
Association between phosphodiesterase 4D gene and ischaemic stroke.
J. Neurol. Neurosurg. Psychiatry, September 1, 2006; 77(9): 1067 - 1069.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Q. Song, J. W. Cole, J. R. O'Connell, O. C. Stine, M. Gallagher, W. H. Giles, B. D. Mitchell, M. A. Wozniak, B. J. Stern, J. D. Sorkin, et al.
Phosphodiesterase 4D polymorphisms and the risk of cerebral infarction in a biracial population: the Stroke Prevention in Young Women Study
Hum. Mol. Genet., August 15, 2006; 15(16): 2468 - 2478.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
R. Y.L. Zee, S. Cheng, H. H Hegener, H. A. Erlich, and P. M Ridker
Genetic Variants of Arachidonate 5-Lipoxygenase-Activating Protein, and Risk of Incident Myocardial Infarction and Ischemic Stroke: A Nested Case-Control Approach
Stroke, August 1, 2006; 37(8): 2007 - 2011.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
R. Y.L. Zee, V. H. Brophy, S. Cheng, H. H Hegener, H. A. Erlich, and P. M Ridker
Polymorphisms of the Phosphodiesterase 4D, cAMP-Specific (PDE4D) Gene and Risk of Ischemic Stroke: A Prospective, Nested Case-Control Evaluation
Stroke, August 1, 2006; 37(8): 2012 - 2017.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
B. B. Worrall and J. C. Mychaleckyj
PDE4D and Stroke: A Real Advance or a Case of the Emperor's New Clothes?
Stroke, August 1, 2006; 37(8): 1955 - 1957.
[Full Text] [PDF]


Home page
StrokeHome page
V. H. Brophy, S. K. Ro, B. K. Rhees, L.-Y. Lui, J. M. Lee, N. Umblas, L. G. Bentley, J. Li, S. Cheng, W. S. Browner, et al.
Association of Phosphodiesterase 4D Polymorphisms With Ischemic Stroke in a US Population Stratified by Hypertension Status
Stroke, June 1, 2006; 37(6): 1385 - 1390.
[Abstract] [Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
G Kuhlenbaumer, K Berger, A Huge, E Lange, C Kessler, U John, H Funke, D G Nabavi, F Stogbauer, E B Ringelstein, et al.
Evaluation of single nucleotide polymorphisms in the phosphodiesterase 4D gene (PDE4D) and their association with ischaemic stroke in a large German cohort
J. Neurol. Neurosurg. Psychiatry, April 1, 2006; 77(4): 521 - 524.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
D. Woo, R. Kaushal, B. Kissela, P. Sekar, M. Wolujewicz, P. Pal, K. Alwell, M. Haverbusch, I. Ewing, R. Miller, et al.
Association of Phosphodiesterase 4D With Ischemic Stroke: A Population-Based Case-Control Study
Stroke, February 1, 2006; 37(2): 371 - 376.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
H. S. Markus and M. J. Alberts
Update on Genetics of Stroke and Cerebrovascular Disease 2005
Stroke, February 1, 2006; 37(2): 288 - 290.
[Full Text] [PDF]


Home page
StrokeHome page
T. Nakayama, S. Asai, N. Sato, and M. Soma
Genotype and Haplotype Association Study of the STRK1 Region on 5q12 Among Japanese: A Case-Control Study
Stroke, January 1, 2006; 37(1): 69 - 76.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
D. Saleheen, S. Bukhari, S. R. Haider, A. Nazir, S. Khanum, S. Shafqat, M. K. Anis, and P. Frossard
Association of Phosphodiesterase 4D Gene With Ischemic Stroke in a Pakistani Population
Stroke, October 1, 2005; 36(10): 2275 - 2277.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. D. Houslay
The Long and Short of Vascular Smooth Muscle Phosphodiesterase-4 As a Putative Therapeutic Target
Mol. Pharmacol., September 1, 2005; 68(3): 563 - 567.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
36/4/731    most recent
01.STR.0000157587.59821.87v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lõhmussaar, E.
Right arrow Articles by Dichgans, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lõhmussaar, E.
Right arrow Articles by Dichgans, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ETHYLENEDIAMINE TETRAACETIC ACID
Medline Plus Health Information
*Stroke
Related Collections
Right arrow Genetics of Stroke