This Article Abstract Full Text (PDF) All Versions of this Article: 36/4/872    most recent 01.STR.0000157586.20479.fdv1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gault, J. Articles by Awad, I. A. Search for Related Content PubMed PubMed Citation Articles by Gault, J. Articles by Awad, I. A. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Substance via MeSH Genetics Home Reference Related Collections Cerebrovascular disease/stroke Genetics of Stroke Other Vascular biology

(Stroke. 2005;36:872.)
© 2005 American Heart Association, Inc.

Research Reports

Biallelic Somatic and Germ Line CCM1 Truncating Mutations in a Cerebral Cavernous Malformation Lesion

From the Department of Neurosurgery (J.G., P.R.), University of Colorado Health Sciences Center, Denver, Colo; and the Department of Neurosurgery (R.S., I.A.A.), Evanston Northwestern Healthcare, Evanston, Ill.

Correspondence to Judith Gault, 4200 E. 9th Ave, C307, Denver, CO 80262. E-mail judith.gault{at}uchsc.edu

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Background and Purpose— Cerebral cavernous malformations (CCMs) are focal dysmorphic blood vessel anomalies that predispose patients to hemorrhagic stroke and epilepsy. CCMs are sporadic or inherited and 3 genes (CCM1, CCM2, and CCM3) have been identified. However, the role of somatic mutation in CCM genesis has been disputed. The hypothesis that somatic mutations contribute to CCM lesion genesis is tested.

Methods— Mutations were identified by analysis of polymerase chain reaction (PCR) products spanning the 16 CCM1 coding exons with denaturing high-pressure liquid chromatography (DHPLC), cloning, and sequencing. Somatic mutation was verified 3 ways in lesion DNA and RNA samples. The somatic and germ line mutations were shown to be biallelic using allele specific reverse-transcribed PCR amplification and sequence analyses.

Results— A somatic 34-nucleotide deletion in CCM1 is identified in a CCM lesion along with a germ line CCM1 mutation (Q455X). The somatic mutation is not present in DNA or RNA isolated from the patient’s blood. These 2 genetic hits are biallelic.

Conclusions— Identification of biallelic CCM1 somatic and germ line truncating mutations strongly support the "two-hit" mechanism in this CCM lesion.

Key Words: genetics • mutation • stroke, hemorrhagic • vascular malformations

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Autosomal-dominant cerebral cavernous malformation (CCM) (OMIM #116860) is caused by germ line mutations in CCM1, CCM2, or the yet to be identified CCM3 gene. CCM lesions are found in 0.5% to 1% of the population.¹ The "two-hit" mechanism of CCM formation is consistent with findings of new CCM lesions,^2,3as well as multiple lesions in familial CCM cases and single lesions in sporadic cases. The "two-hit" model of CCM lesion genesis has been difficult to prove. One report found 2 different somatic CCM1 mutations in DNA from a single CCM lesion that are predicted to change amino acids.⁴ However, it is not known whether these 2 somatic mutations lead to a truncated CCM1 protein as in all 90 different germ line mutations described to date,^1,5,6 only 4 of which involve amino acid changes.^7,8 In addition, it is not clear whether these somatic mutations are biallelic and in the same cells. In another study, somatic CCM1 mutations were not found in 72 CCM lesions (6 with multiple lesions), although the methods used may have lacked sufficient sensitivity.⁹

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Samples
Informed consent was obtained and DNA isolated from blood and 3 pieces from a surgically excised CCM (QIAamp DNA Mini Kit; Qiagen Inc). Tissue (TRI Reagent; Molecular Research Center, Inc, Cincinnati, Ohio) and blood (mRNA Isolation Kit for Blood/Bone Marrow; Roche Molecular Biochemicals, Mannheim, Germany) RNAs were isolated.

Mutation Detection
Denaturing high-pressure liquid chromatography and automated sequence analyses of polymerase chain reaction (PCR) CCM1 exons 5 to 20 (accession number AC000120 and AF296765) products were used for mutation identification. Tissue, exon 15, had a subtle denaturing high-pressure liquid chromatography change and was fractioned and cloned (TOPO TA Cloning Kits with One Shot TOP10 Chemically Competent Escherichia coli; Invitrogen, Carlsbad, Calif).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Tissue Sample
A 38-mm CCM lesion in the right dorsal midbrain was surgically excised because of significant hemorrhage (Figure 1A) and shown histologically to be a CCM (Figure 1B). Seven additional CCM lesions were visualized with magnetic resonance imaging. The patient has 4 other affected family members.

View larger version (68K): [in this window] [in a new window]   Figure 1. A, Preoperative T1-weighted magnetic resonance imaging scan showing hemorrhaged CCM (arrows). B, CCM histopathology. Red indicates blood-filled vascular caverns (arrows), lined by endothelium (nuclei are black). Collagen is blue. Scale bar, 500 µm, 4x magnification.

Mutations
DNA from blood and tissue from individual 354 showed a CCM1 C1363T germ line transition (Q455X) in exon 14 that has been identified in other Hispanic American individuals.¹ A somatic 34-bp deletion in exon 15 was found in tissue DNA. This mutation was predicted to disrupt the open reading frame (Figure 2A to 2D).

View larger version (31K): [in this window] [in a new window]   Figure 2. A, Somatic mutation changes open reading frame. *Stop codon. Amino acids indicated by capital letters, nucleotide sequences indicated by lowercase letters. B, Agarose gel of CCM1 exon 15 PCR DNA products. DNA Exon 15. Lane 1 shows lesion (169-bp deletion). Lane 2 shows blood (203-bp wild-type [wt]). Lane 3 shows clone with deletion (169-bp). Lane 4 shows 123-bp size standard. C, Expected intron 15 to exon 15 PCR products from genomic DNA using deleted allele-specific primer (top) versus less specific amplification of the wt allele (bottom). D, Agarose gel of reverse-transcribed PCR product RNA Exon 14 to 15. Reverse-transcribed PCR products. Lanes 1 and 4 show 100-bp size standard. Lane 2 shows blood (238 bp). Lane 3 shows lesion (204-bp). E, Schematic of the expected exon 14 to 15 reverse-transcribed PCR products from the deleted allele (top) and the wt allele (bottom).

Cells with Somatic Mutation
PCR products generated with a primer set outside the deletion resulted in 2 bands; the lower deleted allele was barely visible on agarose gel (not shown). Proportions of deleted and normal alleles were determined by denaturing high-pressure liquid chromatography-resolved peak heights (not shown). One sample from the end of the lesion evidenced no deletion, yet the deletion was found in 13.5% to 21% of the DNA (27% to 42% of cells) isolated from 2 other regions from the middle of the lesion, suggesting the somatic mutation is limited to a particular cell type and the ends of the lesion may include normal vessel.

Verification
An allele-specific primer spanning the deletion junctional fragment allowed preferential amplification of the deleted allele found only in tissue DNA (169 bp) and RNA samples (204 bp) (Figure 2B lane 1 and 2D lane 3, respectively). The wild-type allele is detected in the absence of the deleted allele in blood DNA (203 bp) and RNA (238 bp) from the patient (Figure 2B to 2E). The allele-specific primer (AGCTGAGGTGTTTCCCTTT/TG) includes 19 nucleotides common to both wild-type and deleted alleles and 2 nucleotides specific to the other end of the deleted junctional fragment. The RNA result is independent from the DNA results and not caused by PCR contamination.

Biallelic Somatic and Germ Line Mutations
The CCM1 mutations were biallelic in the tissue (Figure 3). Bidirectional sequence analysis of reverse-transcribed PCR products amplified specifically from the deleted allele revealed only wild-type sequence at exon 14 nucleotide 1363 (Figure 3A). Sequence near the exon 15 primer (–34 junction) confirmed that the generation of this lesion reverse-transcribed PCR product was only from transcripts with the deletion (not shown). Sequence analysis of the PCR product generated using an exon 15 primer within the 34-nucleotide deletion (GAGGATCCAGATTAGTCAATTC) that anneals only to wild-type exon 15 alleles indicates lesion transcripts are heterozygous for the exon 14 C1363T mutation (Figure 3B). The nondeleted reverse-transcribed PCR products included transcripts from surrounding normal cells in the lesion.

View larger version (30K): [in this window] [in a new window]   Figure 3. Biallelic analysis of CCM reverse-transcribed PCR products. Sequence analysis at C1363T region of (A) exon 15-deleted allele revealed only wt sequence. Alleles without the exon 15 deletion (B) show heterozygous sequence at nucleotide 1363. C, Three expected reverse-transcribed PCR products.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Although both mutations produced detectable transcripts in the lesion, they presumably truncate the 736-amino acid CCM1 protein to 454 and 525 amino acids. Consistent with a "2-hit" mechanism, these mutations are biallelic in the same cells and likely result in the complete loss of function of CCM1 protein in cells critical to maintaining vascular integrity. Identification of two CCM1 hits in a fraction of cells within a CCM lesion supports the hypothesis that CCM genesis is recessive at the cellular level, requiring homozygous inactivation as a primary event followed by clonal expansion to form dysmorphic vascular caverns. Further investigations are warranted to determine how common this mechanism is. Other mechanisms likely contribute to CCM genesis as well.

	Acknowledgments

 
We thank the patient for participating in this study, and neurosurgeon Robert Breeze for facilitating patient enrollment and for providing a portion of surgically excised lesion. We acknowledge Edna Gamliel, Ling-Jia Hu, Berenice Gitomer, Brian Passerella, Keith Lepsch, and Bette K. Kleinschmidt-DeMasters for technical support. Grant K24NS02153 from the National Institutes of Health in part supported this research.

Received November 26, 2004; revision received December 16, 2004; accepted December 17, 2004.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Gault J, Sarin H, Awadallah NA. Pathobiology of human cerebrovascular malformations: basic mechanisms and clinical relevance. Neurosurgery. 2004; 55: 1–17.[CrossRef][Medline] [Order article via Infotrieve]

2. Brunereau L, Levy C, Laberge S, Houtteville J, Labauge P. De novo lesions in familial form of cerebral cavernous malformations: clinical and MR features in 29 non-Hispanic families. Surg Neurol. 2000; 53: 475–483.[CrossRef][Medline] [Order article via Infotrieve]

3. Labauge P, Brunereau L, Coubes P, Clanet M, Tannier C, Laberge S, Levy C. Appearance of new lesions in two nonfamilial cerebral cavernoma patients. Eur Neurol. 2001; 45: 83–88.[Medline] [Order article via Infotrieve]

4. Kehrer-Sawatzki H, Wilda M, Braun VM, Richter HP, Hameister H. Mutation and expression analysis of the krit1 gene associated with cerebral cavernous malformations (CCM1). Acta Neuropathol (Berl). 2002; 104: 231–240.[Medline] [Order article via Infotrieve]

5. Couteulx SL, Brezin AP, Fontaine B, Tournier-Lasserve E, Labauge P. A novel krit1/CCM1 truncating mutation in a patient with cerebral and retinal cavernous angiomas. Arch Ophthalmol. 2002; 120: 217–218.[Free Full Text]

6. Zhang J, Clatterbuck RE, Rigamonti D, Dietz HC. Mutations in krit1 in familial cerebral cavernous malformations. Neurosurgery. 2000; 46: 1272–1279.[CrossRef][Medline] [Order article via Infotrieve]

7. Verlaan DJ, Siegel AM, Rouleau GA. Krit1 missense mutations lead to splicing errors in cerebral cavernous malformation. Am J Hum Genet. 2002; 70: 1564–1567.[CrossRef][Medline] [Order article via Infotrieve]

8. Cave-Riant F, Denier C, Labauge P, Cecillon M, Maciazek J, Joutel A, Laberge-Le Couteulx S, Tournier-Lasserve E. Spectrum and expression analysis of krit1 mutations in 121 consecutive and unrelated patients with cerebral cavernous malformations. Eur J Hum Genet. 2002; 10: 733–740.[CrossRef][Medline] [Order article via Infotrieve]

9. Reich P, Winkler J, Straube A, Steiger HJ, Peraud A. Molecular genetic investigations in the CCM1 gene in sporadic cerebral cavernomas. Neurology. 2003; 60: 1135–1138.[Abstract/Free Full Text]

This article has been cited by other articles:

				N. Limaye, L. M. Boon, and M. Vikkula From germline towards somatic mutations in the pathophysiology of vascular anomalies Hum. Mol. Genet., April 15, 2009; 18(R1): R65 - R74. [Abstract] [Full Text] [PDF]

				A. Pagenstecher, S. Stahl, U. Sure, and U. Felbor A two-hit mechanism causes cerebral cavernous malformations: complete inactivation of CCM1, CCM2 or CCM3 in affected endothelial cells Hum. Mol. Genet., March 1, 2009; 18(5): 911 - 918. [Abstract] [Full Text] [PDF]

				A. L. Akers, E. Johnson, G. K. Steinberg, J. M. Zabramski, and D. A. Marchuk Biallelic somatic and germline mutations in cerebral cavernous malformations (CCMs): evidence for a two-hit mechanism of CCM pathogenesis Hum. Mol. Genet., March 1, 2009; 18(5): 919 - 930. [Abstract] [Full Text] [PDF]

				G. Boulday, A. Blecon, N. Petit, F. Chareyre, L. A. Garcia, M. Niwa-Kawakita, M. Giovannini, and E. Tournier-Lasserve Tissue-specific conditional CCM2 knockout mice establish the essential role of endothelial CCM2 in angiogenesis: implications for human cerebral cavernous malformations Dis. Model. Mech., March 1, 2009; 2(3-4): 168 - 177. [Abstract] [Full Text] [PDF]

				A. V. Gore, M. G. Lampugnani, L. Dye, E. Dejana, and B. M. Weinstein Combinatorial interaction between CCM pathway genes precipitates hemorrhagic stroke Dis. Model. Mech., November 1, 2008; 1(4-5): 275 - 281. [Abstract] [Full Text] [PDF]

				P. Brouillard and M. Vikkula Genetic causes of vascular malformations Hum. Mol. Genet., October 15, 2007; 16(R2): R140 - R149. [Abstract] [Full Text] [PDF]

				J. R. Corboy, J. Gault, and B. K. Kleinschmidt-DeMasters An adult case of leukoencephalopathy with intracranial calcifications and cysts Neurology, November 28, 2006; 67(10): 1890 - 1892. [Abstract] [Full Text] [PDF]

				N Revencu and M Vikkula Cerebral cavernous malformation: new molecular and clinical insights J. Med. Genet., September 1, 2006; 43(9): 716 - 721. [Abstract] [Full Text] [PDF]

				B. Guclu, A. K. Ozturk, K. L. Pricola, A. Seker, M. Ozek, and M. Gunel Cerebral Venous Malformations Have Distinct Genetic Origin From Cerebral Cavernous Malformations Stroke, November 1, 2005; 36(11): 2479 - 2480. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 36/4/872    most recent 01.STR.0000157586.20479.fdv1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gault, J. Articles by Awad, I. A. Search for Related Content PubMed PubMed Citation Articles by Gault, J. Articles by Awad, I. A. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Substance via MeSH Genetics Home Reference Related Collections Cerebrovascular disease/stroke Genetics of Stroke Other Vascular biology