Donate Help Contact The AHA Sign In Home
American Heart Association
Stroke
Search: search_blue_button Advanced Search
Stroke. 2005;36:1954-1959
Published online before print July 28, 2005, doi: 10.1161/01.STR.0000177517.01203.eb
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
36/9/1954    most recent
01.STR.0000177517.01203.ebv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsuji, K.
Right arrow Articles by Lo, E. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsuji, K.
Right arrow Articles by Lo, E. H.
Related Collections
Right arrow Acute Cerebral Infarction
Right arrow Thrombolysis

(Stroke. 2005;36:1954.)
© 2005 American Heart Association, Inc.


Original Contributions

Tissue Plasminogen Activator Promotes Matrix Metalloproteinase-9 Upregulation After Focal Cerebral Ischemia

Kiyoshi Tsuji; Toshiaki Aoki; Emiri Tejima; Ken Arai; Sun-Ryung Lee; Dmitriy N. Atochin; Paul L. Huang; Xiaoying Wang; Joan Montaner Eng H. Lo

From the Neuroprotection Research Laboratory (K.T., T.A., E.T., K.A., S.-R.L., X.W., E.H.L.), Departments of Neurology and Radiology, Massachusetts General Hospital, and Program in Neuroscience, Harvard Medical School, Charlestown, Mass; Department of Neurosurgery (K.T.), Kinki University School of Medicine, Osaka-sayama, Japan; Cardiovascular Research Center and Department of Medicine (D.N.A., P.L.H.), Massachusetts General Hospital and Harvard Medical School, Charlestown, Mass; Department of Life Science (S.-R.L.), Cheju National University, Korea; and Neurovascular Research Laboratory and the Stroke Unit (J.M.), Hospital Universitario Vall d’Hebron, Barcelona, Spain.

Correspondence to Eng H. Lo, Neuroprotection Research Laboratory, Harvard Medical School, MGH E 149-2401, Charlestown, MA 02129. E-mail lo{at}helix.mgh.harvard.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods and Materials
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background and Purpose— Thrombolytic therapy with tissue plasminogen activator (tPA) in ischemic stroke is limited by increased risks of cerebral hemorrhage and brain injury. In part, these phenomena may be related to neurovascular proteolysis mediated by matrix metalloproteinases (MMPs). Here, we used a combination of pharmacological and genetic approaches to show that tPA promotes MMP-9 levels in stroke in vivo.

Methods— In the first experiment, spontaneously hypertensive rats were subjected to 3 hours of transient focal cerebral ischemia. The effects of tPA (10 mg/kg IV) on ischemic brain MMP-9 levels were assessed by zymography. In the second experiment, wild-type (WT) and tPA knockout mice were subjected to 2 hours of transient focal cerebral ischemia, and MMP-9 levels and brain edema during reperfusion were assessed. Phenotype rescue was performed by administering tPA to the tPA knockout mice.

Results— In the first experiment, exogenous tPA did not change infarct size but amplified MMP-9 levels in ischemic rat brain at 24 hours. Coinfusion of the plasmin inhibitor tranexamic acid (300 mg/kg) did not ameliorate this effect, suggesting that it was independent of plasmin. In the second experiment, ischemic MMP-9 levels, infarct size, and brain edema in tPA knockouts were significantly lower than WT mice. Administration of exogenous tPA (10 mg/kg IV) did not alter infarction but reinstated the ischemic MMP-9 response back up to WT levels and correspondingly worsened edema.

Conclusions— These data demonstrate that tPA upregulates brain MMP-9 levels in stroke in vivo, and suggest that combination therapies targeting MMPs may improve tPA therapy.


Key Words: blood–brain barrier • brain edema • metalloproteinases • mice • tissue plasminogen activator


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods and Materials
down arrowResults
down arrowDiscussion
down arrowReferences
 
Reperfusion is a logical therapeutic approach for ischemic stroke. The National Institute of Neurological Disorders and Stroke (NINDS) and European Cooperative Acute Stroke Study (ECASS) trials suggested that tissue plasminogen activator (tPA) is effective if administered within 3 hours after stroke onset.1 However, use of tPA in stroke remains limited, primarily because of the narrow time-to-treatment windows available for safe and effective therapy.2 Complications may involve increased risks of cerebral hemorrhage and further brain injury.3

Recently, matrix metalloproteinases (MMPs) have been implicated in neurovascular injury after stroke.4–7 MMPs comprise a family of zinc endopeptidases that can modify almost all components of the extracellular matrix.8–10 After stroke, MMPs become upregulated, degrade blood–brain barrier substrates, and promote edema, increased inflammatory infiltration, and parenchymal damage.4–6,9 Combination treatments using MMP inhibitors plus tPA reduce hemorrhage and improve outcomes in animal models of embolic stroke.11,12 Recently, we showed recombinant tPA transcriptionally elevated MMP-9 levels in human cerebral endothelial cells.13 Hence, it is possible that the deleterious induction of hemorrhage and edema after tPA reperfusion may be related in part to MMPs.

In the present study, we tested the hypothesis that tPA promotes MMP-9 dysregulation in stroke in vivo. A combined pharmacological and genetic approach was used in rat and mouse models. In the first set of experiments, we found that addition of exogenous tPA amplified ischemic MMP-9 levels in rats, and this effect was independent of plasmin. In the second set of experiments, tPA gene knockout decreased ischemic MMP-9 and brain edema in mice. Administration of exogenous tPA reinstated the MMP-9 response back to wild-type (WT) levels and worsened edema.


*    Methods and Materials
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods and Materials
down arrowResults
down arrowDiscussion
down arrowReferences
 
Rat and Mouse Models of Focal Cerebral Ischemia
All experiments were performed using an institutionally approved protocol following the National Institutes of Health Guide for the Care and Use of Laboratory Animals. In the first experiment, male spontaneously hypertensive rats weighing 260 to 280 g were anesthetized with halothane (1% to 1.5%) under spontaneous respiration in a 30% O2/70% N2O mixture. Rectal temperatures were maintained at 37±0.5°C with a thermostat-controlled heating pad. The standard intraluminal method (silicon-coated 4.0 monofilament) was used to induce focal ischemia.14 Laser Doppler flowmetry confirmed adequate ischemia. Three hours later, reperfusion was achieved by withdrawal of the occluding filament. Brain MMP-9 levels were measured using gelatin zymography at various times from 6 to 24 hours after ischemia. To assess the effects of exogenous tPA on ischemic MMP-9 responses, saline, tPA (10 mg/kg, 2 mg/mL in saline, over 20 minutes; Genentech), or tPA plus the plasmin inhibitor tranexamic acid (300 mg/kg; Sigma) was infused intravenously into 3 separate groups of rats on reperfusion.

For the second series of experiments, a mouse model of focal ischemia was used. Male tPA knockout mice were compared with matching male C57BL/6 WTs. tPA knockouts have been backcrossed for ≥10 generations into the C57BL/6 background. Under halothane anesthesia (1 to 1.5%), focal ischemia was induced using a standard intraluminal approach using silicon-coated 7.0 monofilaments.15 Core temperature was maintained at 37±0.5°C with a thermostat-controlled heating pad. Consistent ischemia was confirmed with laser Doppler flowmetry. After 2 hours of ischemia, reperfusion was induced by withdrawing the filament. Three groups were studied: WT mice that received saline, tPA knockout mice that received saline, and tPA knockout mice that received tPA (10 mg/kg, 2 mg/mL in saline, over 20 minutes) infused intravenously on onset of reperfusion.

Hydrogen Clearance Measurement of Cerebral Blood Flow
Hydrogen (H2) clearance was used to measure resting cerebral blood flow in WT and tPA knockout mice. The femoral artery was catheterized for monitoring blood pressure. Platinum H2-sensitive electrodes were inserted through a burr hole into the caudate putamen. Reference Ag-AgCl electrodes were attached to the base of the tail. H2 (2.5% in air) was added to anesthetic gaseous mixture via the respirator for 60 seconds before H2 containing gas was added to the base breathing gas and the washout H2-curves were recorded for blood flow calculations. Absolute values of cerebral blood flow (mLx100 g–1xmin–1) were calculated by the initial slope method.

SDS-PAGE Gelatin Zymography
Gelatin zymograms were used to measure the levels of MMP-2 and MMP-9 in ischemic brain homogenates following previously described techniques.15 Briefly, rats or mice were deeply anesthetized and then transcardially perfused with ice-cold PBS, pH 7.4. The brains were quickly removed, divided into ipsilateral ischemic hemispheres and contralateral nonischemic hemispheres, then frozen immediately in liquid nitrogen and stored at –80°C. Samples were homogenized in lysis buffer including protease inhibitors on ice. After centrifugation, supernatant was collected, and total protein concentrations were determined using the Bradford assay (Bio-Rad). Prepared protein samples were loaded and separated by 10% Tris-glycine gel with 0.1% gelatin as substrate. MMP activity was quantified via standard densitometry.

Measurement of Infarction and Edema
Rats and mice were killed 24 hours after induction of focal cerebral ischemia. Coronal brain sections were stained with 2,3,5-triphenyltetrazolium chloride (Sigma). Infarct volume was quantified with a standard computer-assisted image analysis technique. Brain water content was measured using the standard wet–dry method.16 Edema was calculated as the net increase in water content in ipsilateral versus contralateral hemispheres.

Reverse Transcription–Polymerase Chain Reaction
RT-PCR was used to analyze levels of MMP-9 mRNA in sham-operated mice and WT mice at 8 hours after 2 hours of transient ischemia. Mice were killed, perfused with ice-cold PBS, and brains were removed and frozen in liquid nitrogen. Total RNA was isolated using RNeasy mini kit (Qiagen) according to manufacturer instructions. Forward and reverse primers were 5'- GCATACTTGTACCGCTATGG -3' and 5'-TAACCGGAGGTGCAAACTGG -3' for MMP-9 (amplified length was 294 bp), and 5'- TGGAATCCTGTGGCATCCATGAAA -3' and 5'-TAAAACGCAGCTCAGTACAGTCCG -3' for ß-actin (amplified length was 349 bp).

Immunohistochemistry
Mice were transcardially perfused at 24 hours after ischemia. Brains were removed, immersed with 4% paraformaldehyde in PBS overnight at 4°C, and cryoprotected in 30% sucrose in PBS at 4°C. Immunohistochemistry was performed on 20-µm frozen sections using an MMP-9 rabbit polyclonal antibody (1:200; Robert Senior, Washington University, St. Louis, Mo). Negative controls were examined without primary antibody. Double staining was performed using a rat anti-mouse platelet-endothelial cell adhesion molecule-1 (PECAM-1) monoclonol antibody (1:50; Pharmingen).

Statistical Analysis
Quantitative data were expressed as mean±SD. Statistical comparisons were conducted using ANOVA followed by Tukey–Kramer tests for intergroup comparisons. Differences with P<0.05 were considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods and Materials
*Results
down arrowDiscussion
down arrowReferences
 
tPA Promotes MMP-9 After Focal Ischemia in Rats
In the first set of experiments, we aimed to show that tPA amplified MMP-9 in a rat model of 3 hours of transient focal cerebral ischemia. MMP-9 but not MMP-2 levels in the ischemic hemisphere increased over time after stroke onset (Figure 1A). Multiple bands corresponding to what is likely to be pro-MMP-9 and cleaved MMP-9 forms (80 to 92 kDa) were observed on gelatin zymography. To be conservative, total MMP-9 levels (ie, all bands together) were quantified together. Administration of exogenous tPA (10 mg/kg IV) at the onset of reperfusion did not appear to change infarct volumes at 24 hours (303±36 mm3 in saline-treated rats versus 326±23 mm3 in tPA-treated rats). However, tPA significantly amplified MMP-9 levels (P<0.05), approximately doubling the response of this extracellular matrix protease in ischemic brain tissue by 24 hours (Figure 1A and 1B). This phenomenon may be independent of plasmin because cotreatment with the potent plasmin inhibitor tranexamic acid did not alter tPA-amplified MMP-9 responses (Figure 1B).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. A, Representative zymogram showing effects of tPA on ischemic MMP-9 levels. PC indicates human MMP-9 and MMP-2 standards. –, saline injection; +, tPA injection. B, Quantitation of MMP-9 optical density (mean±SD) at 24 hours after focal cerebral ischemia. Addition of exogenous tPA significantly amplified total MMP-9 levels at 24 hours after ischemia. Cotreatment with tranexamic acid as a plasmin inhibitor did not alter outcomes. Optical densities (arbitrary units) were normalized to standards. n=6 per group. *P<0.05 vs ischemia.

MMP-9 Is Reduced in tPA Knockout Mice After Focal Ischemia
In the second set of experiments, the effect of tPA gene knockout on ischemic MMP-9 regulation was examined in mouse brain. Because MMP-9 responses could potentially be influenced by cerebral blood flow and different degrees of ischemia in the various mouse strains and conditions used here, we initially checked baseline and ischemic perfusion levels. H2 clearance electrodes demonstrated that cerebral blood flow was similar in WT (73±15 mL/100 g per minute) and tPA knockout mice (78±19 mL/100 g per minute). Resting arterial blood pressures were also similar: 89±4 mm Hg in WTs and 87±3 mm Hg in tPA knockout mice. On onset of middle cerebral artery occlusion, cortical perfusion rapidly dropped <15% of preocclusion baselines in all mice; levels of cerebral ischemia were similar in all groups (Table).


View this table:
[in this window]
[in a new window]
 
Laser Doppler Flowmetry After Ischemia

In nonischemic WT brain, baseline MMP-9 levels were very low. After 2 hours of transient focal ischemia, MMP-9 was upregulated; RT-PCR showed increased MMP-9 mRNA levels (Figure 2A), consistent with the findings of increased MMP-9 protein. To assess the spatial distribution of MMP-9 after transient focal cerebral ischemia in our mouse models, immunohistochemistry was performed. MMP-9 upregulation in all mice was restricted to the ischemic hemisphere coinciding with the occluded middle cerebral artery territory comprising cortex and striatum. Immunoreactive MMP-9 signals appeared mainly to be associated with vascular-like structures that stained positive for PECAM-1, a marker for endothelial cells (Figure 2B). Overall, the degree of MMP-9 staining appeared lower in tPA knockout mice compared with WTs. To quantify these MMP-9 profiles, gelatin zymography was performed. At 24 hours after ischemic onset, brain MMP-9 protein levels were markedly increased, as expected. However, compared with WT mice, tPA knockouts had significantly reduced MMP-9 levels (P<0.05; Figure 3A and 3B). Because it has been reported that tPA knockout mice may have smaller ischemic infarcts under some conditions, it is possible that the reduction in MMP-9 may be an indirect effect attributable to changes in infarction and severity of tissue damage. In the present study, infarct volumes were indeed smaller in our tPA knockouts (88±9 mm3) compared with WT mice (116±7 mm3). However, when the data were normalized to calculate "MMP-9 per cubic mm of infarct," the ischemic MMP-9 responses were still significantly lower in tPA knockouts versus WT mice (P<0.05; Figure 3C). Finally, brain edema at 24 hours after ischemia was also significantly lower in tPA knockouts compared with WT mice (P<0.05; Figure 3D).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. A, RT-PCR analysis of MMP-9 mRNA. After 2 hours of ischemia plus 6 hours of reperfusion, MMP-9 mRNA levels were increased. B, Immunohistochemistry of brain within peripheral areas of the ischemic cortical zone showed that ischemic MMP-9 was colocalized with PECAM-1 stained endothelial cells. MMP-9 levels appeared to be lower in tPA knockout mice compared with WT mice (a and b). Ischemic MMP-9 levels appeared to be increased after administration of exogenous tPA to tPA knockout mice (b and c). Negative controls incubated without primary antibody showed no staining (data not shown). Bar=200 µm. WT saline indicates WT mice that received saline; KO saline, tPA knockout mice that received saline; KO tPA, tPA knockout mice that received tPA on reperfusion onset.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. A, Representative zymogram at 24 hours after 2 hours of transient focal ischemia in mice. Ischemic MMP-9 in tPA knockouts were lower than WT mice. Exogenous tPA amplified MMP-9 in tPA knockout mice. PC indicates murine MMP-9 and human MMP-2. B, Densitometric analysis (mean±SD). Ischemic MMP-9 was lower in tPA knockouts (KOs) compared with WT mice. Intravenous tPA in knockout mice reinstated ischemic MMP-9 back up to WT levels. Optical densities (arbitrary units) were normalized to standards. n=8 per group. *P<0.05 vs sham; **P<0.05 vs WT saline; ***P<0.05 vs KO saline. C, Ischemic MMP-9 responses (arbitrary units) in WT, saline-treated tPA knockouts and tPA-treated tPA knockouts after being normalized by average infarct volumes in each strain. *P<0.05 vs WT. D, Brain water content measurement of cerebral edema in mice after 2 hours of transient focal cerebral ischemia. Data expressed as net increase in water content in ipsilateral vs contralateral hemispheres (mean+SD; n=6 WT mice; n=8 tPA knockouts treated with saline; n=8 tPA knockouts treated with 10 mg/kg tPA IV at onset of reperfusion. *P<0.05 vs WT; #P<0.05 between saline and tPA-treated mice.

Exogenous tPA Reinstates Ischemic MMP-9 Response in tPA Knockout Mice
To determine the specificity of our findings, a "phenotype rescue" experiment was performed. Administration of tPA in tPA knockout mice did not affect infarct volumes (88±9 mm in knockouts versus 76±8 mm3 in knockouts treated with tPA intravenously). But adding exogenous tPA back into tPA knockout mice reinstated the MMP-9 response back up to WT levels (Figure 3A and 3B), even when the data were normalized as "MMP-9 per cubic mm of infarct" (Figure 3C). Correspondingly, brain edema at 24 hours after ischemia was significantly increased in tPA-treated tPA knockout mice compared with saline-treated tPA knockout mice (P<0.05; Figure 3D).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods and Materials
up arrowResults
*Discussion
down arrowReferences
 
Properly titrated use of tPA is beneficial in reperfusing ischemic brain tissue. However, under some circumstances, use of tPA in delayed times after stroke onset induces brain hemorrhage and injury.3 Many potential mechanisms have been proposed, including tPA-mediated N-methyl-D-aspartate excitotoxicity17 and tPA-mediated microglial inflammation.18 Data from experimental models also suggest the involvement of the extracellular protease family of MMPs. MMPs can degrade basal lamina and blood–brain barrier substrates, thus leading to edema and vascular rupture.4–6,9 An emerging hypothesis states that neurovascular complications of tPA reperfusion are attributable to tPA-induced MMP-9 dysregulation in the neurovascular unit.7,19 This hypothesis has been indirectly supported by data showing that combination therapies using broad-spectrum MMP inhibitors reduce tPA-induced hemorrhagic conversion and improve outcomes in experimental clot embolic models of stroke.11,12

In the present study, we used rat and mouse model of focal cerebral ischemia to investigate the relationship between tPA and MMP-9 in vivo. Administration of exogenous tPA doubled the "normal" MMP-9 response after ischemia in rats, tPA gene knockout significantly decreased ischemic MMP-9 levels compared with WT mice, and exogenous tPA reinstated the MMP-9 response back up to WT levels. Together, these pharmacological and genetic data show that tPA can amplify MMP-9 in stroke in vivo. Insofar as MMP-9 may mediate neurovascular injury, this may account for some of the neurotoxic side effects of tPA therapy.7,19,20

How does tPA upregulate MMP-9? In part, this phenomenon may be related to free radicals induced by reperfusion injury because the MMP-9 promoter contains nuclear factor {kappa}B sites.13 In addition, tPA is now recognized to be more than just a clot buster. tPA induces cell signaling in neurons and glia.18,21 Although the precise pathways remain to be fully elucidated, recent studies suggest that the low-density lipoprotein receptor–related protein (LRP) may be involved. Lipoprotein receptors are implicated in vascular actions of apolipoprotein E and amyloid.22 LRP is enriched in brain, possesses signal transduction properties, and binds tPA, thus making it a candidate mechanism for the tPA-induced MMP-9 hypothesis.13,19 We showed previously that exposure of human brain endothelial cells to tPA upregulated MMP-9, and RNA interference suppression of LRP decreased the tPA-induced MMP-9 response.13 Our present study here extends the in vitro data and demonstrates that the tPA–MMP-9 connection may be relevant for stroke in vivo.

Nevertheless, a few caveats may be worth considering. First, although we show that tPA can amplify ischemic MMP-9 responses, the link with brain injury remains indirect. In our "phenotype rescue" experiment, administration of exogenous tPA back into the tPA knockout mouse significantly increased brain edema. However, the degree of edema did not reach WT levels, suggesting that MMP-9 may account for only part of the edema process in our model, and other mechanisms may operate in parallel. A second related caveat involves direct versus indirect tPA effects. A recent study showed that intraventricular injection of tPA into mouse brain triggered blood–brain barrier opening in WT and MMP-9 knockout mice, suggesting that direct tPA actions on the blood–brain barrier occur.23 The relative importance of MMP versus non-MMP pathways remains to be determined. A third caveat involves tPA effects on blood flow. Although we use a mechanical model of arterial occlusion, is it possible that some of our findings are affected by residual thrombosis after filament withdrawal? Others have also proposed that tPA may possess vasoactive actions as well.24 Our H2 clearance data suggest that resting blood flows were similar in WT and tPA knockout brains. And laser Doppler flowmetry suggests that, at least in our mouse model, ischemic insults were comparable in all groups. Hence, it is unlikely that our MMP-9 and edema data were affected by significant differences in cerebral perfusion. However, we cannot unequivocally exclude the possibility that subtle changes in penumbral perfusion may still be present. Perhaps quantitative MRI may eventually be used to tackle this issue. Indeed, our tPA–MMP-9 hypothesis may be consistent with emerging data showing that early blood–brain barrier leakage occurs in tPA-treated stroke patients.25,26 A fourth caveat is related to specific roles of pro-form versus active enzymes, both within blood and brain parenchyma. Although tranexamic acid is a potent plasmin inhibitor, it is not completely specific because it can bind to Kringle 2 domains. How plasminogen, plasminogen activators, and plasmin per se may affect levels of pro-form and active MMPs in vivo remains to be determined. Finally, our focus here was restricted to MMP-9. At least in rodent models, MMP-9 appears to be the dominant protease because MMP-9 knockout mice were protected against stroke,27 whereas MMP-2 knockouts were not.28 However, other MMPs can be activated after cerebral ischemia and trauma.4,8–10 MMP-3 is upregulated after neuroinflammation29 and may ameliorate neuronal apoptosis induced by its endogenous inhibitor tissue inhibitor of metalloproteinase-3.30 MMP-12 is upregulated in intracerebral hemorrhage and spinal cord injury, and suppression of this protease improves functional recovery.31,32 The overall response of the large MMP protease family will have to be carefully considered after tPA therapy for acute ischemic stroke.

Consistent with our experimental data, a linkage between tPA and MMP-9 is beginning to emerge in clinical stroke. Patients with high plasma levels of MMP-9 experience more brain injury with poor outcomes.33 Furthermore, administration of tPA may increase active forms of MMP-9,34 and patients who experience hemorrhagic conversion after tPA had significantly higher levels of plasma MMP-9 compared with those who did not.35 Further studies are warranted to dissect these tPA–MMP-9 signaling pathways and validate them for possible clinical applications. Targeting these pathways may allow us to lengthen the time-to-treatment window for tPA and improve its safety and efficacy in stroke.


*    Acknowledgments
 
This work was supported in part by National Institutes of Health grants R01-NS37074, R01-NS38731, R01-NS40529, R01-NS48422, and P50-NS10828, and a scientist development award from the American Heart Association (X.W.).

Received March 2, 2005; revision received May 3, 2005; accepted June 2, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods and Materials
up arrowResults
up arrowDiscussion
*References
 
1. Hacke W, Brott T, Caplan L, Meier D, Fieschi C, von Kummer R, Donnan G, Heiss WD, Wahlgren NG, Spranger M, Boysen G, Marler JR. Thrombolysis in acute ischemic stroke: controlled trials and clinical experience. Neurology. 1999; 53: S3–S14.[Medline] [Order article via Infotrieve]

2. Marler JR, Goldstein LB. Stroke: t-PA and the clinic. Science. 2003; 301: 1667.[CrossRef]

3. Wardlaw JM, Sandercock PA, Berge E. Thrombolytic therapy with recombinant tissue plasminogen activator for acute ischemic stroke: where do we go from here? A cumulative meta-analysis. Stroke. 2003; 34: 1437–1442.[Abstract/Free Full Text]

4. Rosenberg GA. Matrix metalloproteinase in neuroinflammation. Glia. 2002; 39: 279–291.[CrossRef][Medline] [Order article via Infotrieve]

5. Lo EH, Dalkara T, Moskowitz MA. Mechanisms, challenges and opportunities in stroke. Nat Rev Neurosci. 2003; 4: 399–415.[Medline] [Order article via Infotrieve]

6. del Zoppo GJ, Mabuchi T. Cerebral microvessel responses to focal ishchemia. J Cereb Blood Flow Metab. 2003; 23: 879–894.[CrossRef][Medline] [Order article via Infotrieve]

7. Wang X, Tsuji K, Lee SR, Ning M, Furie KL, Buchan AM, Lo EH. Mechanisms of hemorrhagic transformation after tPA reperfusion therapy for ischemic stroke. Stroke. 2004; 35 (suppl 1): 2726–2730.[Abstract/Free Full Text]

8. Yong VW, Power C, Forsyth P, Edwards DR. Metalloproteinases in biology and pathology of the nervous system. Nat Rev Neurosci. 2001; 2: 502–511.[CrossRef][Medline] [Order article via Infotrieve]

9. Lo EH, Wang X, Cuzner ML. Extracellular proteolysis in brain injury and inflammation: role for plasminogen activators and matrix proteinases. J Neurosci Res. 2002; 69: 1–9.[CrossRef][Medline] [Order article via Infotrieve]

10. Visse R, Nagase H. Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ Res. 2003; 92: 827–839.[Abstract/Free Full Text]

11. Lapchack PA, Arujo DM, Pakola S, Song D, Wei J, Zivin JA. Microplasmin: a novel thrombolytic that improves behavioral outcome after embolic strokes in rabbits. Stroke. 2002; 33: 2279–2284.[Abstract/Free Full Text]

12. Sumii T, Lo EH. Involvement of matrix metalloproteinase in thrombolysis-associated hemorrhagic transformation after embolic focal ischemia in rats. Stroke. 2002; 33: 831–836.[Abstract/Free Full Text]

13. Wang X, Lee SR, Arai K, Lee SR, Tsuji K, Rebeck GW, Lo EH. Lipoprotein receptor-mediated induction of matrix metalloproteinase by tissue plasminogen activator. Nat Med. 2003; 9: 1313–1317.[CrossRef][Medline] [Order article via Infotrieve]

14. Aoki T, Sumii T, Mori T, Wang X, Lo EH. Blood-brain barrier disruption and matrix metalloproteinase-9 expression during reperfusion injury: mechanical versus embolic focal ischemia in spontaneously hypertensive rats. Stroke. 2002; 33: 2711–2717.[Abstract/Free Full Text]

15. Asahi M, Asahi K, Jung JC, del Zoppo GJ, Fini ME, Lo EH. Role for matrix metalloproteinase-9 after focal cerebral ischemia: effects of gene knockout and enzyme inhibition with BB-94. J Cereb Blood Flow Metab. 2000; 20: 1681–1690.[CrossRef][Medline] [Order article via Infotrieve]

16. Hatashita S, Hoff JT, Salamat SM. Ischemic brain edema and the osomotic gradient between blood and brain. J Cereb Blood Flow Metab. 1988; 8: 552–559.[Medline] [Order article via Infotrieve]

17. Fernandez-Monreal M, Benchenane K, Cacquevel M, Rossier J, Jarrige AC, Mackenzie ET, Colloc’h N, Ali C, Vivien D. Arginine 260 of the NR1 subunit is critical for tPA-mediated enhancement of NMDA receptor signaling. J Biol Chem. 2004; 279: 50850–50856.[Abstract/Free Full Text]

18. Siao CJ, Tsirka SE. Tissue plasminogen activator mediates microglial activation via its finger domain through annexin II. J Neurosci. 2002; 22: 3352–3358.[Abstract/Free Full Text]

19. Lo EH, Broderick JP, Moskowitz MA. tPA and proteolysis in the neurovascular unit. Stroke. 2004; 35: 354–356.[Free Full Text]

20. Benchenane K, Lopez-Atalaya JP, Fernandez-Monreal M, Touzani O, Vivien D. Equivocal roles of tissue-type plasminogen activator in stroke-induced injury. Trends Neurosci. 2004; 27: 155–160.[CrossRef][Medline] [Order article via Infotrieve]

21. Son H, Seuk Kim J, Mogg Kim J, Lee SH, Lee YS. Reciprocal actions of NCAM and t-PA via a Ras-dependent MAPK activation in rat hippocampal neurons. Biochem Biophys Res Commun. 2002; 298: 262–268.[CrossRef][Medline] [Order article via Infotrieve]

22. Herz J, Strickland DK. A multifunctional scavenger and signaling receptor. J Clin Invest. 2001; 108: 779–784.[CrossRef][Medline] [Order article via Infotrieve]

23. Yepes M, Sandkvist M, Moore EG, Bugge TH, Strickland DK, Lawrence DA. Tissue type plasminogen activator induces opening of the blood-brain barrier via the LDL receptor-related protein. J Clin Invest. 2003; 112: 1533–1540.[CrossRef][Medline] [Order article via Infotrieve]

24. Nassar T, Akkawi S, Shina A, Haj-Yehia A, Bdeir K, Tarshis M, Heyman SN, Higazi AA. In vitro and in vivo effects of tPA and PAI-1 on blood vessel tone. Blood. 2004; 103: 897–902.[Abstract/Free Full Text]

25. Warach S, Latour LL. Evidence of reperfusion injury, exacerbated by thrombolytic therapy, in human focal brain ischemia using a novel imaging marker of early blood-brain barrier disruption. Stroke. 2004; 35 (suppl 1): 2659–2661.[Abstract/Free Full Text]

26. Latour LL, Kang DW, Ezzeddine MA, Chalela JA, Warach S. Early blood-brain barrier disruption in human focal brain ischemia. Ann Neurol. 2004; 56: 468–477.[CrossRef][Medline] [Order article via Infotrieve]

27. Asahi M, Wang X, Mori T, Sumii T, Moskowitz MA, Fini ME, Lo EH. Effects of matrix metalloproteinase-9 gene knockout on the proteolysis of blood brain barrier and white matter components after cerebral ischemia. J Neurosci. 2001; 21: 7724–7732.[Abstract/Free Full Text]

28. Asahi M, Sumii T, Fini ME, Itohara S, Lo EH. Matrix metalloproteinase 2 gene knockout has no effect on acute brain injury after focal ischemia. NeuroReport. 2001; 17: 3003–3007.

29. Mun-Bryce S, Lukes A, Wallace J, Lukes-Marx M, Rosenberg GA. Stromelysin-1 and gelatinase A are upregulated before TNF-alpha in LPS-stimulated neuroinflammation. Brain Res. 2002; 933: 42–49.[CrossRef][Medline] [Order article via Infotrieve]

30. Wetzel M, Rosenberg GA, Cunningham LA. Tissue inhibitor of metalloproteinases-3 and matrix metalloproteinase-3 regulate neuronal sensitivity to doxorubicin-induced apoptosis. Eur J Neurosci. 2003; 18: 1050–1060.[CrossRef][Medline] [Order article via Infotrieve]

31. Power C, Henry S, del Bigio MR, Corbett D, Imai Y, Yong VW, Peeling J. Intracerebral hemorrhage induces macrophage activation and matrix metalloproteinases. Ann Neurol. 2003; 53: 731–742.[CrossRef][Medline] [Order article via Infotrieve]

32. Wells JE, Rice TK, Nuttall RK, Edwards DR, Zekki H, Rivest S, Yong VW. An adverse role for matrix metalloproteinase 12 after spinal cord injury in mice. J Neurosci. 2003; 23: 10107–10115.[Abstract/Free Full Text]

33. Castellanos M, Leira R, Serena J, Pumar JM, Lizasoain I, Castillo J, Davalos A. Plasma metalloproteinase-9 concentration predicts hemorrhage transformation in acute ischemic stroke. Stroke. 2003; 34: 40–46.[Abstract/Free Full Text]

34. Horstmann S, Kalb P, Koziol J, Gardner H, Wagner S. Profiles of matrix metalloproteinases, their inhibitors, and laminin in stroke patients: influence of different therapies. Stroke. 2003; 34: 2165–2170.[Abstract/Free Full Text]

35. Montaner J, Molina CA, Monasterio J, Abilleira S, Arenillas JF, Ribo M, Quintana M, Alvarez-Sabin J. MMP-9 pretreatment level predicts hemorrhagic complications after thrombolysis in human stroke. Circulation. 2003; 107: 598–603.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
E. Cuadrado, L. Ortega, M. Hernandez-Guillamon, A. Penalba, I. Fernandez-Cadenas, A. Rosell, and J. Montaner
Tissue plasminogen activator (t-PA) promotes neutrophil degranulation and MMP-9 release
J. Leukoc. Biol., July 1, 2008; 84(1): 207 - 214.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
O. Moldes, T. Sobrino, M. Millan, M. Castellanos, N. Perez de la Ossa, R. Leira, J. Serena, J. Vivancos, A. Davalos, and J. Castillo
High Serum Levels of Endothelin-1 Predict Severe Cerebral Edema in Patients With Acute Ischemic Stroke Treated With t-PA
Stroke, July 1, 2008; 39(7): 2006 - 2010.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
X. Wang, J. Liu, H. Zhu, E. Tejima, K. Tsuji, Y. Murata, D. N. Atochin, P. L. Huang, C. Zhang, and E. H. Lo
Effects of Neuroglobin Overexpression on Acute Brain Injury and Long-Term Outcomes After Focal Cerebral Ischemia
Stroke, June 1, 2008; 39(6): 1869 - 1874.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
F. Adhami, D. Yu, W. Yin, A. Schloemer, K. A. Burns, G. Liao, J. L. Degen, J. Chen, and C.-Y. Kuan
Deleterious Effects of Plasminogen Activators in Neonatal Cerebral Hypoxia-Ischemia
Am. J. Pathol., June 1, 2008; 172(6): 1704 - 1716.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
A. Rosell, E. Cuadrado, A. Ortega-Aznar, M. Hernandez-Guillamon, E. H. Lo, and J. Montaner
MMP-9-Positive Neutrophil Infiltration Is Associated to Blood-Brain Barrier Breakdown and Basal Lamina Type IV Collagen Degradation During Hemorrhagic Transformation After Human Ischemic Stroke
Stroke, April 1, 2008; 39(4): 1121 - 1126.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
T. Saguchi, H. Onoue, M. Urashima, T. Ishibashi, T. Abe, and H. Furuhata
Effective and Safe Conditions of Low-Frequency Transcranial Ultrasonic Thrombolysis for Acute Ischemic Stroke: Neurologic and Histologic Evaluation in a Rat Middle Cerebral Artery Stroke Model
Stroke, March 1, 2008; 39(3): 1007 - 1011.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
P. J. Kelly, J. D. Morrow, M. Ning, W. Koroshetz, E. H. Lo, E. Terry, G. L. Milne, J. Hubbard, H. Lee, E. Stevenson, et al.
Oxidative Stress and Matrix Metalloproteinase-9 in Acute Ischemic Stroke: The Biomarker Evaluation for Antioxidant Therapies in Stroke (BEAT-Stroke) Study
Stroke, January 1, 2008; 39(1): 100 - 104.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
E. E. Benarroch
Tissue plasminogen activator: Beyond thrombolysis
Neurology, August 21, 2007; 69(8): 799 - 802.
[Full Text] [PDF]


Home page
Am. J. Neuroradiol.Home page
K. Lin, K.S. Kazmi, M. Law, J. Babb, N. Peccerelli, and B.K. Pramanik
Measuring Elevated Microvascular Permeability and Predicting Hemorrhagic Transformation in Acute Ischemic Stroke Using First-Pass Dynamic Perfusion CT Imaging
AJNR Am. J. Neuroradiol., August 1, 2007; 28(7): 1292 - 1298.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
G. J. del Zoppo, R. Milner, T. Mabuchi, S. Hung, X. Wang, G. I. Berg, and J. A. Koziol
Microglial Activation and Matrix Protease Generation During Focal Cerebral Ischemia
Stroke, February 1, 2007; 38(2): 646 - 651.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
B.-Q. Zhao, E. Tejima, and E. H. Lo
Neurovascular Proteases in Brain Injury, Hemorrhage and Remodeling After Stroke
Stroke, February 1, 2007; 38(2): 748 - 752.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
M. Millan, T. Sobrino, M. Castellanos, F. Nombela, J. F. Arenillas, E. Riva, I. Cristobo, M. M. Garcia, J. Vivancos, J. Serena, et al.
Increased Body Iron Stores Are Associated With Poor Outcome After Thrombolytic Treatment in Acute Stroke
Stroke, January 1, 2007; 38(1): 90 - 95.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Krizanac-Bengez, M. Hossain, V. Fazio, M. Mayberg, and D. Janigro
Loss of flow induces leukocyte-mediated MMP/TIMP imbalance in dynamic in vitro blood-brain barrier model: role of pro-inflammatory cytokines
Am J Physiol Cell Physiol, October 1, 2006; 291(4): C740 - C749.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
D. C. Hess
NXY-059: A Hopeful Sign in the Treatment of Stroke
Stroke, October 1, 2006; 37(10): 2649 - 2650.
[Full Text] [PDF]


Home page
J. Immunol.Home page
J. A. Fulcher, S. T. Hashimi, E. L. Levroney, M. Pang, K. B. Gurney, L. G. Baum, and B. Lee
Galectin-1-Matured Human Monocyte-Derived Dendritic Cells Have Enhanced Migration through Extracellular Matrix
J. Immunol., July 1, 2006; 177(1): 216 - 226.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S.-R. Lee, H.-Y. Kim, J. Rogowska, B.-Q. Zhao, P. Bhide, J. M. Parent, and E. H. Lo
Involvement of matrix metalloproteinase in neuroblast cell migration from the subventricular zone after stroke.
J. Neurosci., March 29, 2006; 26(13): 3491 - 3495.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
36/9/1954    most recent
01.STR.0000177517.01203.ebv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsuji, K.
Right arrow Articles by Lo, E. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsuji, K.
Right arrow Articles by Lo, E. H.
Related Collections
Right arrow Acute Cerebral Infarction
Right arrow Thrombolysis