| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Stroke. 2006;37:1296.)
© 2006 American Heart Association, Inc.
Original Contributions |
From the Departments of Neurology (J.W., R.S., S.S., O.C., I.Z., M.B.) and Neuropathology (A.W., W.S.-S.), University of Goettingen Medical School, Germany.
Correspondence to Jens Weise, MD, Department of Neurology, University of Goettingen Medical School, Robert-Koch-Str. 40, 37075 Goettingen, Germany. E-mail jweise{at}gwdg.de
| Abstract |
|---|
|
|
|---|
Methods PrP knockout (Prnp0/0) and Prnp+/+ wild-type (WT) mice were subjected to 60-minute transient or permanent focal cerebral ischemia followed by infarct volume analysis 24 hours after lesion. To identify effects of PrPc deletion on mechanisms regulating ischemic cell death, expression analysis of several proapoptotic and antiapoptotic proteins was performed at 6 and 24 hours after transient ischemia and in nonischemic controls using Western blot or immunohistochemistry.
Results Prnp0/0 mice displayed significantly increased infarct volumes after both transient or permanent ischemia when compared with WT animals (70.2±23 versus 13.3±4 mm3; 119.8±24 versus 86.4±25 mm3). Expression of phospho-Akt (Ser473) was significantly reduced in Prnp0/0 compared with WT animals both early after ischemia and in sham controls. Furthermore, postischemic caspase-3 activation was significantly enhanced in the basal ganglia and the parietal cortex of Prnp0/0 mice. In contrast, expression of total Akt, Bax, and Bcl-2 did not differ between both groups.
Conclusions These results demonstrate that PrPc deletion impairs the antiapoptotic phosphatidylinositol 3-kinase/Akt pathway by resulting in reduced postischemic phospho-Akt expression, followed by enhanced postischemic caspase-3 activation, and aggravated neuronal injury after transient and permanent cerebral ischemia.
Key Words: caspases cerebral ischemia PrPc proteins signal transduction
| Introduction |
|---|
|
|
|---|
Therefore, we analyzed the extent of ischemic brain injury in Prnp0/0 and wild-type (WT) mice after both transient and permanent focal cerebral ischemia. To elucidate effects of PrPc deletion on molecular mechanisms involved in regulating ischemia-induced cell death, we performed an expression analysis of various proapoptotic and antiapoptotic proteins including Akt, phospho-Akt, Bax, Bcl-2, and activated caspase-3 in Prnp0/0 and WT mice at different time points after transient ischemia and under nonischemic conditions.
| Materials and Methods |
|---|
|
|
|---|
All mice used in this study were genotyped using a published polymerase chain reaction (PCR) protocol using 3 primers (RK1: TCAGCCTAAATACTGGGCAC; RK2: GCCTAGACCACGAGAAATGC; and RK3: GCATCAGCCATGATGGATAC) to identify either the nontransgenic PrP gene in WT mice (combining RK1+RK2) or the disrupted PrP gene in Prnp0/0 mice (RK1+RK3: amplification of a 730-bp fragment containing the Neo cassette).21 DNA was extracted from tail biopsies of all mice used. PCR mixture contained 200 µmol/L each dNTP, 0.4 µmol/L RK1, 0.4 µmol/L RK2, 0.4 µmol/L RK3, 1.25 U of Taq DNA Polymerase (Promega), 5 mmol/L TrisHCl, pH 8.0, 10 mmol/L NaCl, and 0.9 mmol/L MgCl2. PCR was performed as follows: 1 cycle at 95°C, 120 seconds followed by 35 cycles: starting with 95°C, 60 seconds for denaturation; followed by 62°C, 60 seconds for annealing and completed by 72°C, 60 seconds for polynucleotide extension. PCR was completed by a final step at 72°C, 300 seconds.
Animals were kept under diurnal conditions and allowed free access to food and water.
Induction of Focal Cerebral Ischemia
All experimental procedures were performed according to the National Institutes of Health guidelines for the care and use of laboratory animals and approved by local authorities. Animals were anesthetized with 1% to 1.5% isofluran (30% O2, remainder N2O). Rectal temperature was maintained at 36.5°C to 37°C using a feedback-controlled heating system. For assessment of cerebral blood flow (CBF), laser Doppler flow was recorded during all experiments using a 0.5-mm fiber optic probe (Perimed) attached to the skull overlying the core region of the middle cerebral artery (MCA) territory (2-mm posterior, 6-mm lateral from bregma). Focal cerebral ischemia was induced by permanent or transient occlusion of the MCA using the intraluminal filament technique as described previously.18 After a midline neck incision, the left common and external carotid artery were isolated and ligated. After placing a microvascular clip (Aesculap) on the internal carotid artery, an 80 silicon resin (Xantopren)coated nylon monofilament (Ethilon; diameter 180 to 200 µm; Ethicon) was introduced through an incision into the distal part of the common carotid artery and, after clip removal, advanced 9 mm distal from the carotid bifurcation for MCA occlusion.
For permanent ischemia, the thread was left in situ and fixed by ligation of the distal common carotid artery. For transient ischemia, the monofilament was withdrawn after 60 minutes of ischemia to allow reperfusion of the MCA. Laser Doppler flow recording continued for 15 minutes after the end of operations to monitor either permanent reduction of CBF (<30% of initial CBF) or appropriate reperfusion.
Infarct Volume Analysis
Prnp0/0 and WT mice were euthanized by an overdose of isofluran 24 hours after induction of transient (n=6 per group) or permanent (n=8 per group) cerebral ischemia. Brains were removed, sectioned into 5 equidistant slices (slice thickness: 2 mm), and incubated with a 2% 2,3,5-triphenyle-tetrazoliumchloride solution (15 minutes) to visualize infarcted tissue. Areas of infarction were measured by subtracting the nonlesioned area of the left (infarcted) hemisphere from the area of the right (noninfarcted) hemisphere in all slices using an image analysis system (NIH Image 3.12). Infarct volumes were calculated by integration of lesion areas.
Western Blot Analysis
Prnp0/0 and WT mice were euthanized by an overdose of isofluran at 6 and 24 hours (n=4 per group and time point) after onset of transient cerebral ischemia. Sham-operated Prnp0/0 and WT mice (n=4 per group) were used as nonischemic controls. Brains were removed and shock-frozen. Left (ischemic) hemispheres of individual mice were complemented with lysis buffer (50 mmol/L Tris, pH 8.0, 150 mmol/L NaCl, 1% Triton X-100, and protease inhibitors), homogenized, centrifuged, and supernatants used for SDS-PAGE.
For Western blot analysis, equal amounts of protein (40 µg) were diluted in 6x sample buffer, boiled, and loaded onto 10% to 15% polyacrylamide gels. Proteins were transferred onto polyvinylidene difluoride membranes, which were immersed in blocking solution (5% milk, 0.1% Tween 20 in TBS) for 1 hour at room temperature (RT) and incubated with different mouse monoclonal (anti-Bcl-2: 1:1000; Santa Cruz Biotechnology; antiß-tubulin [loading control]: 1:5000; Sigma-Aldrich) or rabbit polyclonal (antiphospho-Akt (Ser473)/anti-Akt: 1:1000; Cell Signaling; anti-Bax: 1:1000; Santa Cruz Biotechnology) antibodies in 5% BSA/Tris-buffered saline with Tween-20 (TBST) (18 hours; 4°C). Membranes were incubated with a peroxidase-coupled, goat anti-mouse or anti-rabbit secondary antibody (1:2000 in 1% milk/TBST; Santa Cruz Biotechnology; 1 hour at RT), immersed in enhanced chemiluminescence (ECL) solution, and exposed to ECL-Hyperfilm (Amersham).
The intensity of each Akt and phospho-Akt band was measured by densitometry (ScanMaker4; Microtek International) and normalized to intensities of corresponding ß-tubulin bands (internal control) by calculating densitometry ratios Akt/ß-tubulin and phospho-Akt/ß-tubulin.
Activated Caspase-3 Immunohistochemistry
Prnp0/0 and WT mice were intraperitoneally injected with chloralhydrate (420 mg/kg body weight) and transcardiacally perfused with 4% paraformaldehyde at 6 and 24 hours after onset of ischemia (n=3 per group/time point). Brains were removed, postfixed in paraformaldehyde, embedded in paraffin, and 2-µm coronar sections were prepared. Sections were deparaffinized, boiled in 0.2% citrate buffer, incubated with blocking solution (0.3% Triton X-100; 10% normal goat serum (NGS) in PBS; 1 hour at RT), and a rabbit polyclonal anti-activated caspase-3 antibody (1:1000 in 2% NGS, 0.3% Triton X; overnight at RT; CM-1; Becton Dickinson). After several washing steps and staining with a goat anti-rabbit, Cy-3conjugated secondary antibody (1:400; Dianova; 1 hour at RT), sections were stained with 4',6-diamidino-2-phenylindole (nuclear staining).
For activated caspase-3/NeuN double staining, sections were incubated with the rabbit polyclonal anti-activated caspase-3 antibody (CM1, see above) and a mouse monoclonal anti-NeuN antibody (1:500; Chemicon International) overnight at 4°C, followed by staining with a goat anti-rabbit Cy-3conjugated (see above) and a goat anti-mouse fluorescein isothiocyanateconjugated secondary antibody (1:100; Sigma-Aldrich; 1 hour at RT). Subsequently, sections were analyzed for activated caspase-3/NeuN colocalization.
Quantitative Analysis of Activated Caspase-3 Expression
Cell counts of activated caspase-3positive cells were performed in ischemic basal ganglia (4 visual fields per section; total area 1.6 mm2, including medial and lateral striatum) and parietal cortex (2 visual fields per section; total area 0,8 mm2) of Prnp0/0 and WT mice 24 hours after induction of transient ischemia (n=3 per group). To standardize cell counts, areas to be analyzed within the 2 brain regions were defined by stereotactic coordinates. Four corresponding sections per animal and region were analyzed. Data are given as number of activated caspase-3positive cells per mm2.
Statistical Analysis
All values are given as mean±SEM. Normal distribution of the data were tested and confirmed using the KolgoroffSmirnoff Test. Statistical analysis was performed using the 2-sided Student t test (infarct volume analysis, analysis of activated caspase-3positive cells; statistical significance: P values <0.05) or 1-way ANOVA followed by the Tukey HSD (honestly significant difference) test (Western Blot analysis of phospho-Akt/Akt).
| Results |
|---|
|
|
|---|
|
|
Reduction of CBF and the extent of reperfusion (after transient ischemia) were not significantly different between Prnp0/0 and WT animals (data not shown).
Reduced Phospho-Akt Expression in Prnp0/0 Mice
Quantitative Western blot analysis of phosphorylated (ie, activated) Akt and total Akt expression revealed significant phospho-Akt upregulation 6 hours after transient ischemia compared with nonischemic controls in WT but not Prnp0/0 mice. Moreover, phospho-Akt expression in nonischemic controls and especially 6 hours after induction of ischemia was significantly reduced in Prnp0/0 compared with WT mice (Figure 3A and 3B). Twenty-four hours after lesion, we observed a trend for higher phospho-Akt expression in WT mice, but differences were not statistically significant. In contrast, total Akt expression did not significantly differ between Prnp0/0 and WT animals, both after ischemia and in nonischemic controls (Figure 3A; densitometric data not shown). This suggests impaired Akt activation in Prnp0/0 mice with reduced phospho-Akt expression early after ischemic brain injury and in nonischemic mice.
|
Enhanced Postischemic Neuronal Caspase-3 Activation in Prnp0/0 Mice
Quantitative analysis of antiactivated caspase-3 immunohistochemistry revealed a significant increase in the number of activated caspase-3positive cells in the basal ganglia and in the adjacent parietal cortex of ischemic hemispheres in Prnp0/0 compared with WT animals at 24 hours after transient ischemia (Figures 4 and 5
). Double-staining experiments with the neuron-specific marker NeuN revealed that caspase-3 activation occurred predominantly in neurons (Figure 4). Six hours after onset of ischemia, we observed only very few activated caspase-3positive cells within the striatum of both Prnp0/0 and WT animals (data not shown). This suggests enhanced postischemic apoptosis in Prnp0/0 mice.
|
|
Expression of Bax and Bcl-2 Does Not Differ Between Prnp0/0 and WT Mice
Western blot analysis of Bax and Bcl-2 expression at 6 and 24 hours after onset of transient ischemia and in nonischemic controls did not reveal relevant differences between Prnp0/0 and WT mice (Figure 6). This argues against a relevant interaction of PrPC with Bax and Bcl-2 expression after cerebral ischemia in vivo.
|
| Discussion |
|---|
|
|
|---|
The antiapoptotic PI3K/Akt/phospho-Akt pathway mediates neuronal survival after cerebral ischemia.23,24 Blocking this pathway increases activation of caspase-3, a crucial mediator of apoptosis.25 Furthermore, it has been demonstrated that transient early postischemic upregulation of phospho-Akt occurs in the cortex but not the ischemic core and is associated with reduced TUNEL staining after transient ischemia.24 We therefore hypothesize that reduced phospho-Akt levels in Prnp0/0 mice early after stroke lead to enhanced postischemic apoptosis reflected in larger infarcts. This hypothesis is supported by our observation that the number of activated caspase-3 expressing neurons is significantly higher in Prnp0/0 than in WT animals, especially in the parietal cortex. Because total Akt levels do not differ between Prnp0/0 and WT animals, lower phospho-Akt expression in Prnp0/0 mice is attributable to reduced Akt phosphorylation. This is in line with a recent study demonstrating lower PI3K activity, an upstream regulator of Akt phosphorylation, in neuronal cells from mice lacking PrPc compared with WT cells.11
In contrast to another study reporting increased basal cerebral expression of Bax and Bcl-2 in Prnp0/0 mice,13 we did not detect relevant differences in Bax and Bcl-2 expression between Prnp0/0 and WT animals in nonischemic brains or after transient ischemia. In our view, this argues against a relevant role for Bax and Bcl-2 in PrPc-dependent susceptibility to cerebral ischemia.
Short transient and permanent focal cerebral ischemia differ with regard to the molecular mechanisms involved in mediating postischemic cell death. Whereas permanent ischemia (by proximal MCA occlusion) leads to large infarcts with neuronal damage primarily mediated by excitotoxicity and necrosis, short transient ischemia results primarily in apoptotic cell death, especially in the penumbra.26 Considering these differences, we tried to establish whether PrPc deletion is relevant for infarct development after both transient and permanent ischemia. Although PrPc deletion led to significantly increased infarct volumes after transient and permanent ischemia, differences were more pronounced after transient ischemia. This may be attributable to the predominant role of neuronal apoptosis and the importance of the PI3K/Akt pathway after transient ischemia as opposed to a lesser significance after permanent ischemia. However, additional pathways (eg, MAPK/ERK19) or molecular events mediating necrotic cell death (eg, poly(ADP-ribose)polymerase [PARP] activation) may also contribute to enhanced ischemic brain injury in Prnp0/0 mice.
In summary, our results demonstrate that PrPc deletion impairs the antiapoptotic PI3K/Akt pathway by leading to reduced postischemic phospho-Akt expression, followed by enhanced postischemic caspase-3 activation, and aggravated neuronal injury after both transient and permanent cerebral ischemia in vivo.
| Acknowledgments |
|---|
Received December 2, 2005; revision received February 3, 2006; accepted February 8, 2006.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Khosravani, Y. Zhang, S. Tsutsui, S. Hameed, C. Altier, J. Hamid, L. Chen, M. Villemaire, Z. Ali, F. R. Jirik, et al. Prion protein attenuates excitotoxicity by inhibiting NMDA receptors J. Cell Biol., May 1, 2008; 181(3): 551 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Linden, V. R. Martins, M. A. M. Prado, M. Cammarota, I. Izquierdo, and R. R. Brentani Physiology of the Prion Protein Physiol Rev, April 1, 2008; 88(2): 673 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-J. Lee, A. Panzera, D. Rogawski, L. E. Greene, and E. Eisenberg Cellular prion protein (PrPC) protects neuronal cells from the effect of huntingtin aggregation J. Cell Sci., August 1, 2007; 120(15): 2663 - 2671. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Stroke Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |