Donate Help Contact The AHA Sign In Home
American Heart Association
Stroke
Search: search_blue_button Advanced Search
Stroke. 2007;38:1189-1196
Published online before print March 1, 2007, doi: 10.1161/01.STR.0000260099.42744.b0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
38/4/1189    most recent
01.STR.0000260099.42744.b0v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Worrall, B. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Worrall, B. B.
Related Collections
Right arrow Genetics of Stroke
Right arrow Genetics of cardiovascular disease

(Stroke. 2007;38:1189.)
© 2007 American Heart Association, Inc.


Original Contributions

IL1RN VNTR Polymorphism in Ischemic Stroke

Analysis in 3 Populations

Bradford B. Worrall, MD, MSc; Thomas G. Brott, MD; Robert D. Brown, Jr, MD; W. Mark Brown, MA; Stephen S. Rich, PhD; Sampath Arepalli, BS; Fabienne Wavrant-De Vrièze, PhD; Jaime Duckworth, MS; Andrew B. Singleton, PhD; John Hardy, PhD; James F. Meschia, MD for the SWISS, ISGS, and MSGD Investigators*

From Departments of Neurology (B.B.W.) and Public Health Sciences (B.B.W.), University of Virginia Health System, Charlottesville, Va; Department of Neurology (T.G.B., J.F.M.), Mayo Clinic, Jacksonville, Fla; Department of Neurology (R.D.B.), Mayo Clinic, Rochester, Minn; Department of Public Health Sciences (W.M.B., S.S.R.), Wake Forest University, Winston-Salem, NC; National Institute on Aging (S.A., F.W.-D., J.D., A.B.S., J.H.), Neurogenetics Laboratory, Bethesda, Md.

Correspondence to James F. Meschia, MD, Department of Neurology, Mayo Clinic, 4500 San Pablo Rd, Jacksonville, FL 32224. E-mail meschia.james{at}mayo.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowAppendix
down arrowReferences
 
Background and Purpose— Genetic factors influence risk for ischemic stroke and likely do so at multiple steps in the pathogenic process. Variants in genes related to inflammation contribute to risk of stroke. The purpose of this study was to confirm our earlier finding of an association between allele 2 of a variable number tandem repeat of the IL-1 receptor antagonist gene (IL1RN) and cerebrovascular disease.

Methods— An association study of the variable number tandem repeat genotype with ischemic stroke and stroke subtypes was performed on samples from a North American study of affected sibling pairs concordant for ischemic stroke and 2 North American cohorts of prospectively ascertained ischemic stroke cases and unrelated controls. DNA analysis was performed on cases and controls, stratified by race.

Results— After adjustment for age, sex, and stroke risk factors, the odds ratio for association of allele 2 and ischemic stroke was 2.80 (95% confidence interval, 1.29 to 6.11; P=0.03) for the white participants. The effect of allele 2 of IL1RN on stroke risk most closely fits a recessive genetic model (P=0.009). For the smaller sample of nonwhite participants, the results were not significant.

Conclusions— Allele 2 of IL1RN, present in nearly one-quarter of stroke patients, may contribute to genetic risk for ischemic stroke and confirm the previously identified association with cerebrovascular disease. These results are driven by the association in the white participants. Further exploration in a larger nonwhite sample is warranted.


Key Words: atherosclerosis • genetics • IL-1 receptor antagonist • ischemia • stroke


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowAppendix
down arrowReferences
 
Genetic determinants of ischemic stroke risk have not yet been fully characterized. Ischemic stroke is undoubtedly an oligogenic (genes of large and small effect on risk) and multifactorial (genetic and environmental effects) disease. Genes coding for inflammatory mediators hold promise as candidates for determining risk for both cerebrovascular atherosclerosis and ischemic stroke.1,2

IL-1 receptor antagonist (IL-1ra) is a counter-inflammatory cytokine implicated in a number of inflammatory diseases, including atherosclerosis. The IL-1ra gene (IL1RN) contains an 86-basepair variable number tandem repeat (VNTR) polymorphism in intron 2.3 Allele 2 of that polymorphism (IL1RN*2) is the shortest of the 5 alleles, with only 2 repeats. Carriage of IL1RN*2 is increased in carotid atherosclerosis,4 and an IL1RN point mutation that is in strong linkage disequilibrium with this VNTR polymorphism has been reported in association with carotid wall thickness in a cohort of black patients.5 Similar data support an association of IL1RN*2 with coronary atherosclerosis.6,7

Animal and cell culture data suggest a biological effect of this genetic variant that is plausibly linked to vascular disease through unchecked inflammation. IL-1ra has been found to be downregulated in microarray analyses of endothelial cells under continuous shear stress, which mimics conditions in atherosclerosis-resistant long straight segments.8 Human endothelial cells from homozygotes for IL1RN*2 have 2- to 3-fold lower IL-1ra production than homozygotes for IL1RN*1, with heterozygotes producing an intermediate level.9 Laboratory analyses of endothelial cells from individuals homozygous for allele 2 show lower IL-1ra production and a shorter time for cell division compared with those from allele 1 homozygotes. Treating with exogenous IL-1ra slows division to the wild-type rate.10

Knockout mice lacking IL-1ra develop lethal inflammatory vascular lesions; hemizygous mice develop fibrotic lesions at vascular branch points11 and have excessive neointimal formation and inflammation after injury.12 IL-1ra depletion increases foam cell burden, whereas overexpression suppresses atherosclerosis in susceptible mice.13 Pigs subjected to vessel wall injury and then treated with exogenous IL-1ra have a marked reduction in neointimal formation compared with untreated animals.14

In an earlier case-control study, we identified an association between carotid atherosclerosis and allele 2, the short variant of the VNTR polymorphism of IL1RN.4 In that study, carriers of allele 2 had >13-fold increase in the risk of carotid disease (adjusted odds ratio [OR], 13.78; 95% confidence interval [CI], 1.94 to 97.9) after adjusting for stroke risk factors; however, there was no significant association between IL1RN*2 and cerebrovascular symptoms. In the current analysis, we sought to replicate and expand on these earlier findings by determining whether the IL1RN genotype is associated with ischemic stroke risk or symptomatic large vessel atherosclerosis using samples from 3 independent sources.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowAppendix
down arrowReferences
 
Two multicenter stroke genetics studies and a single-center stroke genetics database were the source of the DNA samples used in this study. Institutional review board approval was obtained at all participating institutions. In addition, the current analysis was reviewed and approved by the University of Virginia Human Investigations Committee. In all instances, subjects were enrolled after they or their surrogate provided written informed consent. The 2 larger studies used the Trial of Org 10172 in Acute Stroke Treatment (TOAST) criteria for stroke subtyping, blinded to genotypic information.15

Ischemic Stroke Genetics Study
The Ischemic Stroke Genetics Study (ISGS), an ongoing 5-center, case-control study of first-ever ischemic stroke that began enrolling in December 2002, was designed to investigate candidate genes from the thrombosis and hemostasis cascade. Details of the protocol have been published elsewhere.16 Potential case subjects are invited to participate in ISGS if they have had a stroke radiologically confirmed to be ischemic within the preceding 30 days and have no history of ischemic stroke. Subjects with iatrogenic stroke and stroke caused by septic embolism, vasospasm, or certain monogenetic disorders are excluded. Controls are concurrently enrolled and individually matched for age, sex, and recruitment center. Once eligibility is confirmed, blood samples are obtained for DNA extraction, analysis, and storage.

Mayo Stroke Genetics Database
The Mayo Stroke Genetics Database (MSGD) was derived from 50 cases and 50 unrelated controls prospectively enrolled at Mayo Clinic and St. Luke’s Hospital, Jacksonville, Florida, from November 15, 2000 to November 2, 2001. MSGD established the feasibility of ISGS. The inclusion and exclusion criteria for cases and controls matched those of ISGS with the exception that MSGD allowed recurrent stroke for entry. Age- and sex-matched controls were concurrently enrolled with cases at each site. The MSGD was developed with approval from the Mayo Foundation Institutional Review Board.

Siblings With Ischemic Stroke Study
The Siblings With Ischemic Stroke Study (SWISS), a multicenter family study, was designed to identify genetic risk factors through a genome-wide linkage screen in sibling pairs concordant and discordant for ischemic stroke. Details of the protocol have been previously published.17 SWISS comprised 49 enrolling centers across the United States and Canada. Potential probands were invited to participate in SWISS if they had a stroke radiologically confirmed to be ischemic and reported having at least 1 living sibling with a history of ischemic stroke. Once concordance was verified by medical record review, blood samples were obtained from proband, concordant sibling, and, if applicable, discordant sibling, for DNA extraction, analysis, and storage.

Molecular Genetic Analyses
Immortalized lymphoblastoid cell line creation and DNA extraction were performed at Coriell Institute for Medical Research (Camden, New Jersey) using methods described elsewhere.16,17 Briefly, DNA samples were delivered to the Laboratory of Neurogenetics of the National Institute on Aging, where all genetic analyses were performed. All samples were analyzed blinded to clinical status. Polymerase chain reaction amplification was performed on {approx}25 ng of genomic DNA with 10 pmol of forward (ACTCATGGCCTTGTTCATT) and reverse (AAAACTAAAATCCCGAGGTC) primers, according to manufacturer’s specifications (Thermo-Start PCR Master Mix, ABgene). Polymerase chain reaction products were run on a 2% agarose gel. Allele calling for the 86-basepair VNTR of IL1RN was based on sample migration on the gel versus a 100-basepair ladder. Data were dually and independently entered for quality assurance.

Quality control was performed on the entire batch of 886 samples, including samples from the 145 affected and unaffected siblings not used for the genetic analyses. Every plate had negative controls, and the call rate for negative controls was 100%. Replicates were both concurrent and sequential. The sample plates are designed with 148 samples, where multiple wells were filled with the same DNA as concurrent replicates. An additional 157 samples were randomly chosen for replicate analysis. A total of 389 samples (44% of total) were run more than once. Ninety-one percent (802/886) yielded usable results on the first run. The 84 samples that did not yield usable results on the first run were rerun a minimum of 2 times. The majority of these yielded replicated results immediately (2 additional runs). However, for a small number, including the 3 samples that never yielded usable results, we returned to the master plate and reamplified the DNA. A single pair of genotyping errors was found in the concurrent replicates. These were subsequently identified as a known mislabeling of wells on the master plate. All results were consistent when the wells were correctly labeled. Only 3 samples failed to yield results; thus, genotyping success was 99.7%.

Statistical Methods
To describe the study group, categorical data were reported as frequencies and percentages, and continuous data were reported as means with standard deviations. A 2-sample test for binomial proportions between cases and controls was reported using a {chi}2 test of independence. The Fisher exact test was used where appropriate. A 2-sample t test for independent samples was used to compare age among groups.

Although the distribution of genotypes is similar within all 3 studies, there are significant differences by race. Therefore, all analyses were performed stratified by race (white/nonwhite) to minimize population stratification.

Results were examined for Hardy-Weinberg equilibrium assumptions using the methods described by Wigginton et al.18 Association analyses were performed to estimate ORs for the IL1RN VNTR polymorphism with case-control status. Genotype frequencies of IL1RN were compared by case-control and symptom status using contingency tables and logistic regression models. For the primary analysis, individuals with rare alleles (3, 4, and 5) were excluded from the analyses. Two secondary analyses were run including the rare alleles but pooling them with allele 1 and allele 2.

For the case-control data, a series of generalized estimating equations19 was computed that included relevant covariates (age, sex, hypertension, atrial fibrillation, myocardial infarction, smoking status, diabetes mellitus, and family history of stroke). All modeling was performed in a hierarchical manner, with a baseline model that included only the single nucleotide polymorphism as the predictor. Additional models were tested with age and sex; further models were then tested by adding an individual stroke risk factor variable as a covariate. A final, fully saturated model that included stroke risk factors was also used. Probability values were computed using the 2 degree-of-freedom generalized test of association. A series of genetic models was tested (dominant, additive, recessive) for estimation of best fit for risk. Results were examined only when the generalized test reached statistical significance.

Differences in the distribution of IL1RN genotypes within cases according to TOAST subtype versus controls were determined using {chi}2 tests. Comparisons were made for cases according to large vessel subtype for the index stroke and any evidence of large vessel cerebrovascular atherosclerotic disease, including history of carotid procedures.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowAppendix
down arrowReferences
 
DNA from 328 cases and 213 controls from ISGS and 48 cases and 48 controls from MGSD were available; samples from 104 probands, 104 affected siblings, and 41 unaffected siblings from SWISS were available (Table 1). Among those used for the case-control analyses, 158 (21.3%) of 741 subjects were nonwhite. Allele frequencies for the 3 study groups were 72.5% (allele 1), 24.9% (allele 2), 2.4% (allele 3), 0.28% (allele 4), and 0% (allele 5), which are findings consistent with other published estimates in North American populations.20 The allelic and genotypic frequencies overall and stratified by race (Table 2) were consistent with Hardy-Weinberg expectations (data not shown). Furthermore, the genotype distribution among the 3 groups (together and pairwise) in cases was not significantly different. This result was true also for the controls in ISGS and MSGD. Thus, all cases were pooled for the primary analysis, as were the 2 control groups.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Demographic, Stroke Risk Factor, and Subtype Characteristics of the Study Population


View this table:
[in this window]
[in a new window]

 
TABLE 2. Genotypes of the Study Population and Race

As shown in Table 2, the IL1RN 1/1 genotype was present in 262 (54.8%) of 478 cases/probands and 149 (57.1%) of 261 controls. The IL1RN 1/2 genotype occurred in 151 (31.6%) of 478 cases/probands and 85 (32.6%) of 261 controls. The frequency of the IL1RN 2/2 genotype was 42 (8.8%) of 478 cases/probands and 13 (5.0%) of 261 controls. The frequency of IL1RN genotypes containing at least one of the rare alleles (3, 4, or 5) was 25 (5.2%) of 478 cases/probands and 14 (5.4%) of 261 controls. The allele frequency for IL1RN*2 in the nonwhite participants was 9.6% (29/302), much lower than that observed in the white participants, which was 28.8% (317/1102).

Among white participants, the unadjusted association model demonstrated a nonsignificant increase in risk associated with the IL1RN 2/2 genotype (OR, 1.95; 95% CI, 0.98 to 3.90; P=0.16). Adjustment for age, sex, and stroke risk factors (hypertension, diabetes mellitus, atrial fibrillation, coronary disease, smoking status, and family history) strengthened the independent association of the IL1RN 2/2 genotype with ischemic stroke risk in white participants (OR, 2.8; P=0.03, for the fully adjusted general association; P=0.009 for a recessive mode of inheritance; Table 3).


View this table:
[in this window]
[in a new window]

 
TABLE 3. Models: Cases From 3 Cohorts (SWISS, ISGS, and MSGD) and Controls From ISGS and MSGD Cohorts Stratified by Race

For nonwhite participants, the genotype distributions were not significantly different between cases and controls in either the unadjusted model (OR, 1.50; 95% CI, 0.15 to 14.86; P=0.94) or the fully adjusted model (OR, 1.54; 95% CI, 0.10 to 24.67; P=0.95; Table 3).

Including rare alleles and their genotypes did alter the results. For the white participants, grouping the rare alleles with IL1RN*1 increased the adjusted OR to 2.71 (95% CI, 1.23 to 5.98; P=0.04); the general association strongly supported the recessive mode of inheritance (P=0.01) of risk. When the rare alleles were grouped with IL1RN*2, the adjusted OR of 2.09 (95% CI, 1.02 to 4.28; P=0.13) was no longer significant for general association. The recessive model of inheritance remained marginally significant (P=0.05).

Prespecified subgroup analyses of the cases from ISGS and affected individuals from SWISS (MSGD did not include TOAST subtyping) were performed to compare genotypes and allele frequencies for those with large vessel atherosclerotic mechanism and controls among white and nonwhite participants. In the white cohort, the IL1RN 1/1 genotype was present in 38 (47.5%) of 80 subjects with large vessel atherosclerosis and 117 (47.4%) of 247 with other mechanisms. IL1RN 1/2 occurred in 31 (38.8%) of 80 with large vessel atherosclerosis and 91 (36.8%) of the 247 others. The frequency of IL1RN 2/2 was 8 (10.0%) of 80 with large vessel atherosclerosis, and 23 (9.3%) in the 247 others. The frequency of IL1RN genotypes containing at least one of the rare alleles (3, 4, or 5) was 3 (3.8%) of 80 with large vessel atherosclerosis, and 16 (6.5%) in the 247 others. Neither the genotype (P=0.43) nor the allele (P=0.27) frequencies for those with large vessel atherosclerotic mechanism differed from controls among white participants (Table 4). When individuals with a documented history of carotid atherosclerosis were included (identified by history of carotid endarterectomy, angioplasty, or stent), the genotype and allele distributions were similar. Carriage of IL1RN*2 (having a genotype with at least 1 copy of allele 2) was observed in 39 of 80 subjects with large vessel atherosclerotic stroke compared with 90 of 208 controls (P=0.62).


View this table:
[in this window]
[in a new window]

 
TABLE 4. Large Vessel Atherosclerosis

In the nonwhite cohort, the IL1RN 1/1 genotype was present in 12 (92.3%) of 13 subjects with large vessel atherosclerosis, and 72 (78.3%) of 92 with other mechanisms. IL1RN 1/2 occurred in 1 (7.7%) of 13 with large vessel atherosclerosis, and 13 (14.1%) of the 92 others. The frequency of IL1RN 2/2 was 0 (0.0%) of 13 with large vessel atherosclerosis, and 3 (3.3%) in the 92 others. The frequency of IL1RN genotypes containing at least one of the rare alleles (3, 4, or 5) was 0 (0.0%) of 13 with large vessel atherosclerosis, and 4 (4.3%) in the 92 others. Among nonwhite participants, the genotype frequencies for those with large vessel atherosclerotic mechanism did not differ from controls (P=0.72). When individuals with a documented history of carotid atherosclerosis were included (identified by history of carotid endarterectomy or angioplasty and stent), the genotype distributions were similar. Carriage of IL1RN*2 was observed in 1 of 13 subjects with large vessel atherosclerotic stroke compared with 8 of 53 controls (P=0.99).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowAppendix
down arrowReferences
 
Our results indicate that variation within the IL1RN locus, previously implicated as a genetic risk factor for carotid atherosclerosis4 and symptomatic coronary disease,6 is associated with ischemic stroke risk in our white participants. Homozygotes for allele 2, the short variant of the VNTR polymorphism, appear to be at greater risk for ischemic stroke. Because of small sample numbers, the data on our nonwhite participants are inconclusive. The current study did not demonstrate a specific association with large vessel atherosclerosis as the mechanism of stroke.

Homozygous carriers of IL1RN*2 have been shown to have more prolonged and more intense inflammatory responses than those with other genotypes.3 The complexity of cytokine interactions and genetic regulatory mechanisms make it likely that polymorphisms in other genes influence the overall inflammatory phenotype. Composite genotype profiles of the IL-1 gene family are associated with increased risk for either severe periodontal infection (profile 1) or angiographically confirmed coronary atherosclerosis (profile 2).21 Similar interactions between the IL-1ra and IL-1{alpha} genotypes have been observed in ischemic stroke.22 Variations in IL1RN and other related genes may have other effects such as lowering the threshold for susceptibility for ischemic stroke.23 Chlamydial infection may confer greater risk for symptomatic atherosclerotic disease among carriers of IL1RN and IL1B gene mutations out of proportion to the risk conferred by either these mutations or the infection alone;24 not all data support this association.25

Our results contrast with those reported in an earlier Italian study that found a higher frequency of both carriage of the IL1RN*1 allele and homozygosity for IL1RN*1 among stroke survivors than in a control group.26 However, the impact of survival bias must be considered. IL1RN*2 is associated with increased susceptibility to cerebral ischemia,23 which may impact stroke severity and survival. Furthermore, the impact of IL1RN*2 in inflammatory response3 may also affect stroke severity and survival.27

Our association study may have yielded false-positive results because of the stratification of the study groups. Racial and ethnic differences in IL-1 gene family genotype distributions are well-recognized.3 We are reassured that our findings are not an artifact of this stratification, because a significant association remained for IL1RN*2 homozygosity among white subjects in the race-stratified analysis. The failure to find a relationship in the nonwhite population likely reflects both a lack of statistical power to detect a difference and the difference in the allele frequencies noted. Furthermore, the nonwhite group is a heterogeneous mix of subjects. The differences observed in these racial categories should be viewed with caution. Further analyses in larger nonwhite and non-North American populations are warranted.

We found an association of IL1RN*2 with ischemic stroke generally not with specific stroke subtypes. Our previous work demonstrated an association between carotid atherosclerosis but not symptomatic status.4 There are several important differences between these 2 studies. The current study included 93 individuals (21.5%) with large vessel atherosclerosis as the putative mechanism of stroke among a total of 432 individuals with subtyping data with a corresponding reduction in power. Furthermore, we compared cases with and without large vessel atherosclerosis. An association of IL1RN*2 with large vessel atherosclerosis may have been more difficult to detect in this case-only analysis. Similarly, the case-control analysis did not identify subtype-specific associations. In this study, the control population was clinically free of stroke, whereas the earlier study used a stroke-free control group with ultrasound verification of disease-free status. Genetic variation at the IL1RN may play >1 role in the progression of cerebrovascular atherosclerosis to a symptomatic state.

Clearly, IL1RN has potential as a pharmacological target.28 A phase 2 trial of recombinant human IL-1ra (rhIL-1ra) recently demonstrated IL-1ra is safe and well-tolerated in patients with acute stroke.29 Furthermore, active treatment was associated with a less inflammatory serum profile. Exploratory analyses suggest improved outcome for those treated with rhIL-1ra. Unfortunately, the report does not include an analysis of outcome by IL1RN genotype. This kind of pharmacogenomic consideration is prudent given that carriage of IL1RN*2 is associated with both increased risk of hemorrhage and better clinical outcome in other neurologic diseases.30 Further research into this potential treatment is planned.


*    Appendix
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*Appendix
down arrowReferences
 
Siblings With Ischemic Stroke Study Centers and Investigators Listed by Proband Enrollment as of January 31, 2006
Study Centers
Mayo Clinic, Rochester, Minnesota (probands enrolled, 56): principal investigator (PI): Robert D. Brown, Jr, MD; coordinator: Colleen S. Albers, RN; subinvestigators (SI): George W. Petty, MD, Eelco F. M. Wijdicks, MD, Irene Meissner, MD, Bruce A. Evans, MD, Kelly D. Flemming, MD, Edward M. Manno, MD, Jimmy R. Fulgham, MD, David O. Wiebers, MD.

University of Cincinnati, Cincinnati, Ohio (43): PI: Brett Kissela, MD; coordinator: Kathleen Alwell, RN; SI: Joseph Broderick, MD, Daniel Woo, MD, Daniel Kanter, MD, Dawn Kleindorfer, Alexander Schneider, MD, Matthew Flaherty, MD, Pooja Khatri, MD, Brian A. Stettler, MD.

University of Virginia, Charlottesville, Virginia (43): PI: Bradford Worrall, MD, MSc; coordinator: Helen Roehl; SI: E. Clarke Haley, Jr, MD, Karen Johnston, MD, MSc, Jaclyn van Wingerden.

University of Florida/Shands Jacksonville, Jacksonville, Florida (42): PI: Scott Silliman, MD; coordinators: Barbara Quinn, RN, Cicely Bryant.

Mayo Clinic, Jacksonville, Florida (42): PI: Thomas G. Brott, MD; coordinators: Dale M. Gamble, Alexa N. Richie; SI: James F. Meschia, MD, Frank A. Rubino, MD, Benjamin H. Eidelman, MD.

Mercy Ruan Neurology Clinic and Clinical Research Center, Des Moines, Iowa (34): PI: Michael Jacoby, MD; coordinator: Judi Greene, RN; SI: Bruce Hughes, MD, Randall Hamilton, MD, Paul Babikian, MD, Mark Puricelli, DO.

Neurological Associates, Inc, Richmond, Virginia (31): PI: Francis McGee, Jr, MD; coordinator: Janet McGee, CCRC; SI: Stephen Thurston, MD, Thomas Smith, MD, Robert White, MD, Philip Davenport, MD, John Brush, MD, Susanna Mathe, MD, Robert Cohen, MD, J. Kim Harris, MD, John O’Bannon III, MD, John Blevins, MD, John Wittman, MD, Michael Mareska, MD, Daniel Hardy, MD.

Mercy General Hospital, Sacramento, California (19): PI: Paul Akins, MD, PhD; coordinators: Deidre Wentworth, RN, Laura Newman, BSN, RN.

Maine Line Health—Stroke Program, Bryn Mawr, Pennsylvania (18): PI: Gary Friday, MD; coordinator: Angela Whittington-Smith, RN.

Centre Hospitalier Affilie Universitaire de Quebec, Quebec City, Province of Quebec (14): PI: Ariane Mackey, MD; coordinators: Annette Hache, RN, Sophie Dube, RN; SI: Steve Veireault, MD.

Luther-Midelfort Clinic, Eau Claire, Wisconsin (14): PI: Felix Chukwudelunzu, MD; coordinator: Karen Snobl, RN; SI: James Bounds, MD, Rae Hanson, MD, David Nye, MD, Donn Dexter, MD.

Kaleida Stroke Center—Millard Fillmore Hospital, Buffalo, New York (14): PI: Richard Ferguson, MD; coordinator: Kathleen Wrest, MLS; SI: F. E. Munschauer, MD, E. Mark Hekler, MD.

University of Maryland, Baltimore, Maryland (14): PI: Steven Kittner, MD; coordinator: Mary J. Sparks; SI: John Cole, MD.

Maine Medical Center, Portland, Maine (12): PI: John Belden, MD; coordinator: Diane Diconzo-Fanning, RN; SI: Paul Muscat, MD.

University of Pennsylvania Medical Center, Philadelphia, Pennsylvania (12): PI: Scott Kasner, MD; coordinator: Sue Heppler; SI: David S. Liebeskind, MD, Brett L. Cucchiara, MD, Michael L. McGarvey, MD, Steven R. Messe, MD, Robert A. Taylor, MD.

Ohio State University, Columbus, Ohio (12): PI: Andrew Slivka, MD; coordinator: Peggy Notestine, CCRC; SI: Yousef Mohammad, MD.

Mayo Clinic, Scottsdale, Arizona (12): PI: David W. Dodick, MD; coordinators: Erica L. Boyd, RN, Rebecca J. Rush, RN, Gail R. LeBrun, RN, Nadine F. Lendzion, RN, Barbara B. Cleary, RN; SI: Bart M. Demaerschalk, MD.

Wake Forest University School of Medicine, Winston-Salem, North Carolina (11): PI: David Lefkowitz, MD; coordinators: Jean Satterfield, RN, Elizabeth Westerberg, CCRC; SI: Charles Tegeler IV, MD, Patrick Reynolds, MD.

Metro Health Medical Center, Cleveland, Ohio (11): PI: Joseph Hanna, MD; coordinators: Alice Liskay, RN, Joan Kappler, RN, Dana Simcox, RN; SI: Marc D. Winkelman, MD, Nimish Thakore, MD, DM.

University of South Alabama, Mobile, Alabama (11): PI: Richard Zweifler, MD; coordinator: Kelli Boots; SI: Ivan Lopez, MD, M. Asim Mahmood, MD.

Cleveland Clinic Florida, Weston, Florida (10): PI: Virgilio Salanga, MD; coordinator: Anupama Podichetty, MD; SI: Jose Alvarez, MD, Eduardo Locatelli, MD, Nestor Galvez-Jimenez, MD, Efrain Salgado, MD.

Stroke Prevention and Atherosclerosis Research Centre (SPARC), London, Ontario (10): PI: David Spence, MD; coordinator: Rose Freitas; SI: Claudio Munoz, MD.

Hospital Charles Le Moyne, Greenfield Park, Province of Quebec (10): PI: Leo Berger, MD; coordinators: Denise Racicot, Johanne Pontbriand.

University of Iowa Hospital, Iowa City, Iowa (9): PI: Patricia Davis, MD; coordinator: Jeri Sieren, RN; SI: Harold P. Adams, Jr, MD, Enrique C. Leira, MD.

University of Texas Southwestern Medical Center at Dallas, Dallas, Texas (9) PI: Mark Johnson, MD; coordinator: J. Greggory Wright, BS; SI: Dion Graybeal, MD.

Washington University School of Medicine, St. Louis, Missouri (8): PI: Jin-Moo Lee, MD, PhD; coordinator: Denise Shearrer, RMA, BS; SI: Abdullah Nassief, MD.

Helen Hayes Hospital, West Haverstraw, New York (8): PI: Laura Lennihan, MD; coordinator: Laura Tenteromano, RN.

Emory University School of Medicine, Atlanta, Georgia (7): PI: Barney Stern, MD; coordinator: Betty Jo Shipp, RN; SI: Michael Frankel, MD, Marc Chimowitz, MD, Owen Samuels, MD.

University of Wisconsin, Madison, Wisconsin (7): PI: Robert Dempsey, MD; coordinator: Pam Winne; SI: George Newman, MD, Douglas Dulli, MD, Madeleine Geraghty, MD.

Indiana University School of Medicine, Indianapolis, Indiana (7): PI: Linda Williams, MD; coordinator: Kelley Faber; SI: Askiel Bruno, MD, William Jones, MD, James Fleck, MD.

University of California, Davis School of Medicine, Sacramento, California (7): PI: Piero Verro, MD; coordinator: Lisa Wilson.

Marshfield Clinic, Marshfield, Wisconsin (7): PI: Percy Karanjia, MD; coordinator: Kathy Mancl, CCRC; SI: Kenneth Madden, MD.

Inova Fairfax Hospital, Falls Church, Virginia (7): PI: Paul Nyquist, MD; coordinator: Barbara Farmer, RN, MSN.

East Bay Region Associates in Neurology, Berkeley, California (6): PI: Brian Richardson, MD; coordinator: Lauren McCormick.

University of California Los Angeles Stroke Center, Los Angeles, California (6): PI: Jeffery Saver, MD; coordinator: Jill Haines; SI: Bruce Ovbiagele, MD, Scott Selco, MD, Venkatakrishna Rajajee, MD.

Thomas Jefferson University Hospital, Philadelphia, Pennsylvania (6): PI: Rodney Bell, MD; coordinator: Mary-Kathleen Nilson-Whitten, BA; SI: David G. Brock, MD, Carissa Pineda, MD, Kiwon Lee, MD.

Florida Neurovascular Institute, Tampa, Florida (5): PI: Erfan Albakri, MD; coordinator: Judy Jackson, Mary Katherine Taylor, ARNP.

University of Kentucky, Lexington, Kentucky (5): PI: L. Creed Pettigrew, MD; coordinator: Deborah Taylor, MS; SI: Stephen Ryan, MD, Anand G. Vaishnav, MD.

Yale University School of Medicine, New Haven, Connecticut (5): PI: Lawrence Brass, MD; coordinators: Janet Halliday, RN, BS, Karin Nystrom; SI: Mark Gorman, MD.

Scripps Clinic, La Jolla, California (4): PI: Mary Kalafut, MD; coordinator: Krista Greiner, BS, CCRC.

University of California San Diego Stroke Center, San Diego, California (3): PI: Patrick Lyden, MD; coordinators: Nancy Kelly, RN, Janet Werner, RN; SI: Christy Jackson, MD, Thomas Hemmen, MD, Brett Meyer, MD.

Rush-Presbyterian-St Luke’s Medical Center, Chicago, Illinois (3): PI: Sean Ruland, DO, MD; coordinator: Karen Whited, RN; SI: Michael Schneck, MD, Michael Sloan, MD, Phillip Gorelick, MD, MPH.

University of Illinois at Chicago, Chicago, Illinois (3): PI: Cathy Helgason, MD; coordinator: Joan N. Martellotto, RN, PhD.

Johns Hopkins Bayview Medical Center, Baltimore, Maryland (3): PI: Rafael Llinas, MD; coordinator: Janice Alt; SI: Christopher Earley, MD.

Field Neurosciences Institute, Saginaw, Michigan (3): PI: Faith Abbott, MD; coordinator: Richard Herm, RN, BSN, CEN; SI: Malcolm Field, MD, Debasish Mridha, MD.

Medical University of South Carolina, Charleston, South Carolina (3): PI: Timothy Carter, MD; coordinator: Feng Liu, MSN.

Royal University Hospital, Saskatoon, Saskatchewan (3): PI: Ali Rajput, MD; coordinator: Theresa Shirley, RN; SI: Alexander Rajput, MD.

Chattanooga Neurology Associates, Chattanooga, Tennessee (2): PI: Thomas Devlin, MD; coordinators: Patty Wade-Hardie, RN, Tammy Owens, RN; SI: Adele Ackell, MD, Sharon Farber, MD, Ravi Chander, MD, G. Hagan Jackson, MD, Kadrie Hytham, MD, Bruce Kaplan, MD, David Rankine, MD.

Morton Plant Hospital, Clearwater, Florida (2): PI: Ajay Arora, MD; coordinators: Jo Simpson, RN, Teresa Jones, RN, Victoria Bernsee, RN.

Charles R. Drew University of Medicine and Science, Los Angeles, California (1): PI: Lowell Nelson, MD; coordinator: Marcia Montenegro, RN; SI: Derek Knight, MD.

Syracuse VA Medical Center, Syracuse, New York (1): PI: Antonio Culebras, MD; coordinator: Therese Dean, RN.

Rhode Island Hospital, Providence, Rhode Island (1): Janet Wilterdink, MD; coordinator: Carol Cirillo, RN.

Vanderbilt University Medical Center, Nashville, Tennessee (1): PI: Anne O’Duffy, MD; coordinator: Diane Brown, RN.

Executive Committee: James F. Meschia, MD (chair); Thomas G. Brott, MD, Robert D. Brown, Jr, MD, John Hardy, PhD, Stephen S. Rich, PhD.

Operations Committee: James F. Meschia, MD (chair); Thomas G. Brott, MD, Robert D. Brown, Jr, MD, Brett Kissela, MD, John Hardy, PhD, Andrew Singleton, PhD, Stephen S. Rich, PhD, Hattie M. Hanert, Alexa N. Richie.

Stroke Verification Committee: James F. Meschia, MD (chair); Thomas G. Brott, MD, Dale M. Gamble.

Genetics Laboratory
NIH/NIA Laboratory of Neurogenetics, Bethesda, Maryland: John Hardy, PhD, Andrew Singleton, PhD.

Statistical Center
Wake Forest University School of Medicine, Winston-Salem, North Carolina: Stephen S. Rich, PhD, William Mark Brown, PhD.

Clinical Coordinating Center
Mayo Alliance for Clinical Trials, Rochester, Minnesota: Lindsey R. DeGoeys, Hattie M. Hanert.

DNA Repository
Coriell Institute for Medical Research, Camden, New Jersey: Jeanne Beck, PhD.

Phlebotomy Service
Hooper Holmes Incorporated, Healthdex Division, Newark, New Jersey

National Institute of Neurological Disorders and Stroke
Project Officer for ISGS: Scott Janis, PhD

Ischemic Stroke Genetics Study Centers and Investigators as of February 7, 2006
Study Centers
Mayo Clinic, Jacksonville, Florida (subjects enrolled, 208): principal investigator (PI): James F. Meschia, MD; coordinators: Alexa N. Richie, Dale M. Gamble; subinvestigators (SI): Thomas G. Brott, MD, Benjamin H. Eidelman, MD, Pablo R. Castillo, MD, Frank A. Rubino, MD.

University of Florida/Shands Hospital, Jacksonville, Florida (216): PI: Scott Silliman, MD; coordinators: Yvonne Douglas, Marc Lojacono, CCRC; SI: Nader Antonios, MD.

Emory University School of Medicine, Atlanta, Georgia (228): PI: Michael R. Frankel, MD; coordinator: Sharion Smith, RN.

University of Virginia, Charlottesville, Virginia (213): PI: Bradford B. Worrall, MD, MSc; coordinator: Martha Davis.

Mayo Clinic, Rochester, Minnesota (233): PI: Robert D. Brown, Jr, MD; coordinators: Colleen S. Albers, RN, Debra E. Herzig, RN.

Statistical Center
Wake Forest University School of Medicine, Winston-Salem, North Carolina: Stephen S. Rich, PhD, Douglas Case, Wesley Roberson, Laurie Russell.

Genetics Laboratory
Laboratory of Neurogenetics, Bethesda, Maryland: John Hardy, PhD, Andrew Singleton, PhD.

DNA Repository
Coriell Institute for Medical Research, Camden, New Jersey: Judy Keen, PhD.

National Institute of Neurological Disorders and Stroke
ISGS Program Officer: Scott Janis, PhD.

Human Genetics Resource Center Project Officer: Katrina Gwinn-Hardy, MD.

Mayo Stroke Genetics Databank
Clinical investigators: James F. Meschia, MD (PI), Thomas G. Brott, MD, Frank A. Rubino, MD; coordinator: Marc Lojacono; statistical support: Elizabeth J. Atkinson, MS; genetics laboratory: Richard Crook, John Hardy, PhD.


*    Acknowledgments
 
Editing, proofreading, and reference verification were provided by the Section of Scientific Publications, Mayo Clinic.

Sources of Funding

Dr Worrall is supported in part by NIDDK grant P50DK0636091 and NINDS grant K08-NS45802. Dr Meschia receives support from the NINDS for SWISS (R01 NS39987) and ISGS (R01 NS42733). The MSGD was supported by a grant from the Mayo Foundation for Medical Education and Research. ISGS is a contributor to the NINDS Human Genetics Resource Center (http://locus.umdnj.edu/ninds).

Disclosures

None.


*    Footnotes
 
*Members of the SWISS, ISGS, and MSGD Study Groups are listed in the Appendix. Back

Presented in part at the 30th International Stroke Conference, Miami Beach, Florida, February 2005.

Received September 1, 2006; revision received November 22, 2006; accepted November 24, 2006.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
up arrowAppendix
*References
 
1. DeGraba TJ. Immunogenetic susceptibility of atherosclerotic stroke: implications on current and future treatment of vascular inflammation. Stroke. 2004; 35: 2712–2719.[Abstract/Free Full Text]

2. Humphries SE, Morgan L. Genetic risk factors for stroke and carotid atherosclerosis: insights into pathophysiology from candidate gene approaches. Lancet Neurol. 2004; 3: 227–235.[CrossRef][Medline] [Order article via Infotrieve]

3. Witkin SS, Gerber S, Ledger WJ. Influence of interleukin-1 receptor antagonist gene polymorphism on disease. Clin Infect Dis. 2002; 34: 204–209.[CrossRef][Medline] [Order article via Infotrieve]

4. Worrall BB, Azhar S, Nyquist PA, Ackerman RH, Hamm TL, DeGraba TJ. Interleukin-1 receptor antagonist gene polymorphisms in carotid atherosclerosis. Stroke. 2003; 34: 790–793.[Abstract/Free Full Text]

5. Pankow JS, Beck JD, Offenbacher S, Catallier DJ, Bray MS. Association of interleukin-1 gene variants and carotid arterial wall thickness: the ARIC study. Atherosclerosis. 1999; 144 (Suppl 1): 124. Abstract.

6. Francis SE, Camp NJ, Dewberry RM, Gunn J, Syrris P, Carter ND, Jeffrey S, Kaski JC, Cumberland DC, Duff GW, Crossman DC. Interleukin-1 receptor antagonist gene polymorphism and coronary artery disease. Circulation. 1999; 99: 861–866.[Abstract/Free Full Text]

7. Francis SE, Camp NJ, Burton AJ, Dewberry RM, Gunn J, Stephens-Lloyd A, Cumberland DC, Gershlick A, Crossman DC. Interleukin 1 receptor antagonist gene polymorphism and restenosis after coronary angioplasty. Heart. 2001; 86: 336–340.[Abstract/Free Full Text]

8. Chen BP, Li YS, Zhao Y, Chen KD, Li S, Lao J, Yuan S, Shyy JY, Chien S. DNA microarray analysis of gene expression in endothelial cells in response to 24-h shear stress. Physiol Genomics. 2001; 7: 55–63.[Abstract/Free Full Text]

9. Dewberry R, Holden H, Crossman D, Francis S. Interleukin-1 receptor antagonist expression in human endothelial cells and atherosclerosis. Arterioscler Thromb Vasc Biol. 2000; 20: 2394–2400.[Abstract/Free Full Text]

10. Dewberry RM, Crossman DC, Francis SE. Interleukin-1 receptor antagonist (IL-1RN) genotype modulates the replicative capacity of human endothelial cells. Circ Res. 2003; 92: 1285–1287.[Abstract/Free Full Text]

11. Nicklin MJ, Hughes DE, Barton JL, Ure JM, Duff GW. Arterial inflammation in mice lacking the interleukin 1 receptor antagonist gene. J Exp Med. 2000; 191: 303–312.[Abstract/Free Full Text]

12. Devlin CM, Kuriakose G, Hirsch E, Tabas I. Genetic alterations of IL-1 receptor antagonist in mice affect plasma cholesterol level and foam cell lesion size. Proc Natl Acad Sci U S A. 2002; 99: 6280–6285.[Abstract/Free Full Text]

13. Isoda K, Shiigai M, Ishigami N, Matsuki T, Horai R, Nishikawa K, Kusuhara M, Nishida Y, Iwakura Y, Ohsuzu F. Deficiency of interleukin-1 receptor antagonist promotes neointimal formation after injury. Circulation. 2003; 108: 516–518.[Abstract/Free Full Text]

14. Morton AC, Arnold ND, Gunn J, Varcoe R, Francis SE, Dower SK, Crossman DC. Interleukin-1 receptor antagonist alters the response to vessel wall injury in a porcine coronary artery model. Cardiovasc Res. 2005; 68: 493–501.[Abstract/Free Full Text]

15. Adams HP Jr, Bendixen BH, Kappelle LJ, Biller J, Love BB, Gordon DL, Marsh EE III, TOAST Investigators. Classification of subtype of acute ischemic stroke: definitions for use in a multicenter clinical trial. Stroke. 1993; 24: 35–41.[Abstract/Free Full Text]

16. Meschia JF, Brott TG, Brown RD Jr, Crook RJ, Frankel M, Hardy J, Merino JG, Rich SS, Silliman S, Worrall BB. The Ischemic Stroke Genetics Study (ISGS) protocol. BMC Neurol. 2003; 3: 4.[CrossRef][Medline] [Order article via Infotrieve]

17. Meschia JF, Brown RD Jr, Brott TG, Chukwudelunzu FE, Hardy J, Rich SS. The Siblings With Ischemic Stroke Study (SWISS) protocol. BMC Med Genet. 2002; 3: 1.[Medline] [Order article via Infotrieve]

18. Wigginton JE, Cutler DJ, Abecasis GR. A note on exact tests of Hardy-Weinberg equilibrium. Am J Hum Genet. 2005; 76: 887–893.Epub 2005 March 23.[CrossRef][Medline] [Order article via Infotrieve]

19. Liang K-Y, Zeger SL. Longitudinal data analysis using generalized linear models. Biometrika. 1986; 73: 13–22.[Abstract/Free Full Text]

20. Tarlow JK, Blakemore AI, Lennard A, Solari R, Hughes HN, Steinkasserer A, Duff GW. Polymorphism in human IL-1 receptor antagonist gene intron 2 is caused by variable numbers of an 86-bp tandem repeat. Hum Genet. 1993; 91: 403–404.[CrossRef][Medline] [Order article via Infotrieve]

21. Kornman KS, Pankow J, Offenbacher S, Beck J, di Giovine F, Duff GW. Interleukin-1 genotypes and the association between periodontitis and cardiovascular disease. J Periodontal Res. 1999; 34: 353–357.[CrossRef][Medline] [Order article via Infotrieve]

22. Um JY, Moon KS, Lee KM, Kim HM. Interleukin-1 gene cluster polymorphisms in cerebral infarction. Cytokine. 2003; 23: 41–46.[CrossRef][Medline] [Order article via Infotrieve]

23. Dwyer JH, Allayee H, Dwyer KM, Fan J, Wu H, Mar R, Lusis AJ, Mehrabian M. Arachidonate 5-lipoxygenase promoter genotype, dietary arachidonic acid, and atherosclerosis. N Engl J Med. 2004; 350: 29–37.[Abstract/Free Full Text]

24. Momiyama Y, Hirano R, Taniguchi H, Nakamura H, Ohsuzu F. Effects of interleukin-1 gene polymorphisms on the development of coronary artery disease associated with Chlamydia pneumoniae infection. J Am Coll Cardiol. 2001; 38: 712–717.[Abstract/Free Full Text]

25. Rothenbacher D, Brenner H, Mertens T, Hoffmann MM, Hoffmeister A, Koenig W. Prognostic value of interleukin-1 receptor antagonist gene polymorphism and cytomegalovirus seroprevalence in patients with coronary artery disease. BMC Cardiovasc Disord. 2005; 5: 10.[CrossRef][Medline] [Order article via Infotrieve]

26. Seripa D, Dobrina A, Margaglione M, Matera MG, Gravina C, Vecile E, Fazio VM. Relevance of interleukin-1 receptor antagonist intron-2 polymorphism in ischemic stroke. Cerebrovasc Dis. 2003; 15: 276–281.[CrossRef][Medline] [Order article via Infotrieve]

27. Emsley HC, Smith CJ, Gavin CM, Georgiou RF, Vail A, Barberan EM, Hallenbeck JM, del Zoppo GJ, Rothwell NJ, Tyrrell PJ, Hopkins SJ. An early and sustained peripheral inflammatory response in acute ischaemic stroke: relationships with infection and atherosclerosis. J Neuroimmunol. 2003; 139: 93–101.[CrossRef][Medline] [Order article via Infotrieve]

28. Allan SM. Pragmatic target discovery from novel gene to functionally defined drug target: the interleukin-1 story. Methods Mol Med. 2005; 104: 333–346.[Medline] [Order article via Infotrieve]

29. Emsley HC, Smith CJ, Georgiou RF, Vail A, Hopkins SJ, Rothwell NJ, Tyrrell PJ, Acute Stroke Investigators. A randomised phase II study of interleukin-1 receptor antagonist in acute stroke patients. J Neurol Neurosurg Psychiatry. 2005; 76: 1366–1372.[Abstract/Free Full Text]

30. Hadjigeorgiou GM, Paterakis K, Dardiotis E, Dardioti M, Aggelakis K, Tasiou A, Xiromerisiou G, Komnos A, Zintzaras E, Scarmeas N, Papadimitriou A, Korantanas A. IL-1RN and IL-1B gene polymorphisms and cerebral hemorrhagic events after traumatic brain injury. Neurology. 2005; 65: 1077–1082.[Abstract/Free Full Text]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
38/4/1189    most recent
01.STR.0000260099.42744.b0v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Worrall, B. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Worrall, B. B.
Related Collections
Right arrow Genetics of Stroke
Right arrow Genetics of cardiovascular disease