| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Stroke. 2008;39:220.)
© 2008 American Heart Association, Inc.
Original Contributions |
From the Departments of Neurology (J.C., A.Z., A.L., X.C., C.R., M.C.) and of Biostatistics and Research Epidemiology (M.L.), Henry Ford Health Sciences Center, Detroit, and the Department of Physics (M.C.), Oakland University, Rochester, Mich.
Correspondence to Jieli Chen, MD, Neurology Research, E&R Bldg, Room 3056, Henry Ford Hospital, 2799 W Grand Blvd, Detroit, MI 48202. E-mail Jieli{at}neuro.hfh.edu
| Abstract |
|---|
|
|
|---|
Methods— PS1 and NICD expressions were measured in retired breeder rats subjected to middle cerebral artery occlusion that were left untreated or treated with atorvastatin. To investigate the mechanisms of atorvastatin-induced NPC self-renewal, subventricular zone (SVZ) neurosphere culture and knockdown of Notch1 gene expression by short interfering RNA were used. SVZ neurosphere formation, cell proliferation, real-time polymerase chain reaction, and Western blotting were performed.
Results— Atorvastatin significantly increased the numbers of newly generated neuroblasts and promoted PS1 and NICD expression in the ipsilateral and homologous contralateral SVZ compared with saline-treated control rats. Increased SVZ neurosphere formation and cell proliferation were found in cultured neurospheres derived from normal rat and poststroke rat SVZs treated in vitro with atorvastatin compared with untreated neurospheres (P<0.05). Atorvastatin significantly increased PS1 and hairy and enhancer of split1 (Hes1) gene expression in cultured SVZ neurospheres. Inhibition of PS1 significantly decreased NICD expression. Short interfering RNA knockdown of Notch1 expression, decreased NPC proliferation, and NICD and hairy and enhancer of split1 expression in cultured neurosphere cells.
Conclusions— These data indicate that atorvastatin increases the NPC pool in older rats and that it also upregulates PS1 expression and Notch1 signaling activity, which in turn, facilitate an increase in SVZ NPC proliferation.
Key Words: neural stem/progenitor cells Notch1 presenilin1 stroke
| Introduction |
|---|
|
|
|---|
Processing of Notch1 to produce NICD requires presenilin-1 (PS1), a critical component of
-secretase.9 Nuclear translocation of NICD is markedly reduced in PS1-deficient cells and is restored by PS1 transfection.10 PS1 also maintains neural progenitor cell (NPC) proliferation via the Notch signaling pathway.11 PS1 is progressively reduced during aging, resulting in a progressive decrease in
-secretase enzymatic activity, which may cause an age-related decrease in neural cell proliferation.12
Statins, widely used drugs to lower cholesterol, promote NPC proliferation in young adult animals after stroke.13,14 However, the mechanisms underlying statin-induced NPC proliferation have not been fully investigated. In addition, it is unknown whether statins regulate NPC proliferation in the older rat. In this study, we tested the hypothesis that treatment of poststroke rats with atorvastatin promotes NPC proliferation in the retired breeder rat and that atorvastatin increases PS1 expression and activates the Notch1 signaling pathway, which contribute to NPC proliferation.
| Materials and Methods |
|---|
|
|
|---|
Histologic and Immunohistochemical Assessment
Rat brains were fixed by transcardial perfusion with saline followed by perfusion and immersion in 4% paraformaldehyde and embedding in paraffin. The cerebral tissues were cut into 7 equally spaced (2-mm) coronal blocks. A series of adjacent 6-µm-thick sections was cut from each block in the coronal plane. Immunohistochemical staining was used for BrdU (mouse monoclonal antibody, 1:100; Boehringer Mannheim, Indianapolis, Ind), PS1 (1:300 dilution, mouse monoclonal antibody), and NICD (1:3000 dilution, rabbit polyclonal antibody), as previously described.15 Control experiments consisted of staining the brain coronal tissue sections as outlined earlier but without the primary antibodies, as previously described.16
Double Immunohistochemical Staining
To identify the cell type of PS1-reactive cells, double immunofluorescence staining was performed. von Willebrand factor (vWF) is a marker of endothelial cells, glial fibrillary acidic protein (GFAP) is a marker of astrocytes, and β-tubulin III (TuJ1) is a marker of an immature neuronal phenotype. PS1/vWF, PS1/GFAP, PS1/TUJ1, PS1/NICD, NICD/GFAP, NICD/TUJ1, and NICD/vWF double immunohistochemical analyses were performed. A monoclonal antibody against vWF (1:400, Dako, Carpinteria, Calif), a polyclonal antibody against GFAP (1:1000, Dako), and a mouse anti-TUJ1 (1:1000, Novus Biologicals Inc) were used. Fluorescein isothiocyanate (Calbiochem) and cyanine-5.18 (CY5, Jackson Immunoresearch) were used for double-label immunostaining. Each coronal section was first incubated with the primary anti-TUJ1, GFAP, and vWF antibody with Cy5, which was then followed by PS1 or NICD antibody with fluorescein isothiocyanate. Control experiments consisted of staining brain coronal tissue sections as outlined earlier but without the primary antibodies.16
Quantification
BrdU- and NICD-positive cell numbers in the ipsilateral subventricular zone (SVZ) were counted with use of a 3-CCD color video camera (Sony DXC-970MD) interfaced with an MCID image analysis system (Imaging Research, St. Catharines, Canada). The total numbers of BrdU- and NICD-positive cells in the ipsilateral SVZ are presented. PS1-positive areas in the ipsilateral SVZ were digitized under a 20x objective (Olympus BX40) with use of a 3-CCD color video camera (Sony DXC-970MD) interfaced with an MCID image analysis system. The digitized images were then contrast enhanced to clearly differentiate positivity from background, and a thresholding procedure was established to determine the proportion of immunoreactive area within the SVZ.14 The data are presented as a percentage of positive immunoreactivity area in the SVZ.
SVZ Neurosphere Culture
SVZ cells were dissociated from normal and poststroke rats 24 hours after MCAo as reported previously.15 Mechanically dissociated ipsilateral SVZ cells were plated at 3x104 cells/mL in Dulbeccos modified Eagles medium/F-12 medium (R&D Systems) containing 20 ng/mL epidermal growth factor (R&D Systems), 20 ng/mL basic fibroblast growth factor (R&D Systems), L-glutamine (2 mmol/L), 0.6% glucose, and B27. The secondary cultured neurosphere cells derived from poststroke and normal rat SVZs were subjected to no treatment for controls or 0.1 µmol/L atorvastatin treatment for 7 days (n=4 per group). The floating neurosphere number (neurosphere diameter >50 µm) was counted at 7 days.
BrdU ELISA Assay for SVZ Neurosphere Cell Proliferation
To evaluate DNA synthesis,17 secondary normal SVZ neurospheres were plated at 5x104 cells/mL in each well of a 96-well plate (Corning), and SVZ neurospheres were left untreated (controls) or treated with 0.1 µmol/L atorvastatin for 2 days (n=4 per group). BrdU (50 µmol/L) was added to the SVZ neurosphere culture medium for 12 hours before fixation, and samples were processed with an ELISA kit for detection of BrdU incorporated into cellular DNA (BrdU labeling and detection kit III, Roche), according to the manufacturers instructions.
Real-Time PCR
Cells were harvested and total RNA was isolated from treated cells with TRIzol (Invitrogen), according to a standard protocol.18 Quantitative polymerase chain reaction (PCR) was performed with the SYBR green real-time PCR method. Quantitative reverse transcription–PCR was performed on an ABI 7000 PCR instrument (Applied Biosystems, Foster City, Calif) with 3-stage program parameters provided by the manufacturer. Each sample was tested in triplicate, and samples were obtained from 3 independent experiments that were used for analysis of relative gene expression data with the 2–
CT method.18 The following primers for reverse transcription–PCR were designed with primer express software (ABI): forglyceraldehyde 3-phosphate dehydrogenase: forward, AGAACATCATCCCTGCATCC and reverse, CACATTGGGGGTAGGAACAC; for Notch1: forward, TCCTCCTGAGAGTTGTCCTAGC and reverse, GTGGTCTAAGTGACCATCAGCA; for PS1: forward, GAGGAAGACGAAGAGCTGACAT and reverse, GAAGCTGACTGACTTGATGGTG; and for Hes1: forward, ACACCGGACAAACCAAAGAC and reverse, ATGCCGGGAGCTATCTTTCT.
Western Blot Assay
To test whether atorvastatin regulates Notch1 signaling activity and whether PS1 mediates atorvastatin-induced Notch activity, for Western blotting15 normal SVZ neurospheres were left untreated (controls) or treated with (1) 0.1 µmol/L atorvastatin, (2) 10 µmol/L
-secretase inhibitor (
40-secretsae inhibitor II, Calbiochem), or (3) 0.1 µmol/L atorvastatin with 10 µmol/L
-secretase inhibitor for 7 days (n=3 per group). Notch1 and NICD expressions were measured. Protein was isolated from cultured cells with Trizol (Invitrogen) according to a standard protocol. Notch1 (1:500, Santa Cruz Biotech) or NICD (1:500) primary antibody was used. For detection, a secondary anti-mouse antibody (1:1000, Bio-Rad) was added. Optical density was quantified with an image processing and analysis program (Scion Image, Ederick, Mass).
Knockdown Notch1 Gene Expression in Neurosphere Cells
Notch1 short interfering (si) RNA (Santa Cruz Biotech) was transfected with Lipofectamine 2000 (Invitrogen) according to a standard protocol. In brief, normal neurosphere cells were plated out in 10-cm plates and allowed to culture until they were 80% confluent. They were then transfected with 8 µg Notch1 siRNA or 8 µg scrambled siRNA (Santa Cruz Biotech) in serum-free medium for 6 hours. Afterward, Dulbeccos modified Eagles medium and 20% fetal bovine serum were added, and the cells were incubated overnight. The following day the medium was changed, and 24 hours later the cells were passaged for subsequent experiments. Notch1 mRNA and protein expression were measured by real-time PCR and Western blotting.
To test whether knockdown (KD) Notch expression may regulate NICD expression and neurosphere cell proliferation, normal SVZ neurosphere cells were cultured with (1) normal neurosphere cells, (2) scrambled neurosphere cells, (3) Notch1-KD neurosphere cells, (4) Notch1-KD neurosphere cells treated with 0.1 µmol/L atorvastatin, or (5) scrambled neurosphere cells treated with 0.1 µmol/L atorvastatin. Notch1, NICD, and Hes1 protein expression was measured by Western blotting 5 days after treatment. In addition, Ki67 (a marker of proliferating cells) immunostaining was performed (1:300 dilution, Novus) 24 hours after treatment. DAPI was used as a nuclear counterstain. All assays were performed in triplicate. Ki67-reactive cells were counted in 5 randomly selected microscopic fields under a 20x objective. The percentage of Ki67-reactive cells within the total number of DAPI-positive cells was calculated.
Statistical Analysis
For in vivo study, the retired breeder rats were allocated to either control or atorvastatin treatment (3 mg/kg). A 2-sample t test was performed to compare BrdU, NICD, and PS1 expression between the 2 groups. In addition, a 2-sample t test was performed to compare PS1, Notch1, and Hes1 gene expression and neurosphere formation between neurosphere cells treated with atorvastatin or left untreated. The data are presented as mean±SE. A value of P<0.05 was taken as significant.
| Results |
|---|
|
|
|---|
|
Atorvastatin Promotes PS1 and NICD Expression in the SVZ in Retired Breeder Rats
PS1 is a key molecule regulating the activity of the Notch signaling pathway,9 and Notch activity promotes NPC proliferation.6 To test the mechanism of atorvastatin-induced NPC proliferation, PS1 and NICD expression was measured. Nuclear NICD-positive cell number was measured in the ipsilateral SVZ. PS1-reactive cells are primarily expressed on the cytoplasmic surfaces of membranous organelles,19 and it is difficult to count the total number of PS1-positive cells. Therefore, we measured the PS1-positive area in the ipsilateral SVZ. Figure 1 shows that atorvastatin treatment significantly increased PS1 (D–F) and NICD (G–I) expression in the ipsilateral SVZ compared with MCAo controls or sham controls. Double immunostaining showed that PS1-reactive cells in the cytoplasm (green, J and L) colocalized with NICD nuclear positive cells (red, K and L) in the SVZ. PS1 is expressed in the cytoplasm, and NICD is expressed in the nucleus.
Figure 2 shows that doubly immunostained PS1-reactive cells (green; A, D, and G) primarily colocalized with GFAP-positive cells (red, B and C), and some PS1-reactive cells colocalized with TUJ1- (red, E and F) and vWF- (red, H and I) positive cells. Nuclear NICD-reactive cells (green; J, M, and P) primarily colocalized with GFAP- (red, K and L) and vWF- (Q and R) positive cells but not with TUJ1-positive cells (red, N and O).
|
Atorvastatin Increases SVZ Neurosphere Formation and NPC Proliferation
To investigate the mechanisms of atorvastatin-induced NPC proliferation in retired breeder rats, we first tested whether atorvastatin regulates SVZ neurosphere formation in neurosphere cultures derived from poststroke and normal rats. Figure 3 shows that atorvastatin significantly increased neurosphere formation numbers compared with control, untreated neurospheres derived from the normal rat SVZ (A–C, P<0.05) and the poststroke rat SVZ (D). In addition, normal SVZ neurosphere proliferation was measured with a BrdU ELISA assay. Atorvastatin significantly increased SVZ neurosphere cell proliferation compared with untreated control (E, P<0.05). These data suggest that atorvastatin upregulates neurosphere proliferation.
|
Atorvastatin Increases Notch Signaling and PS1 Gene Expression
Notch signaling activity has been implicated in the maintenance and self-renewal of adult NSCs.3 PS1 cleaves Notch and activates Notch signaling.20 Hes is a basic helix-loop-helix type of transcriptional repressor and is downstream of Notch activation.21 To identify the molecular mechanisms underlying atorvastatin-regulated NPC proliferation, PS1, Notch1, and Hes1 genes were measured in normal SVZ neurospheres. Atorvastatin significantly increased the amount of Hes1 (5.7±0.7-fold) and PS1 (4.7±0.9-fold), but not Notch1 (1.4±0.1-fold), mRNA expression compared with untreated neurosphere controls.
PS1 Regulates Atorvastatin-Induced Notch Signaling Activity
To test whether PS1 is involved in atorvastatin-increased Notch signaling activity, cultured normal SVZ neurosphere cells were treated with or without the
-secretase inhibitor (
40-secretase inhibitor II) in vitro, and NICD expression was measured. Figure 4 shows that atorvastatin upregulated SVZ neurosphere NICD protein expression. Inhibition of
-secretase activity attenuated atorvastatin-induced NICD expression. These data suggest that atorvastatin promotes PS1 expression, which may upregulate Notch1 signaling activity.
|
Notch1-KD in SVZ Neurosphere Cells Decreases Neurosphere Cell Proliferation
To test whether Notch signaling regulates SVZ neurosphere cell proliferation, Notch1-KD in SVZ neurosphere cells was used with Notch1 siRNA. Notch1, NICD, and Hes1 expression was measured in Notch1-KD neurosphere cells. Figure 5A shows that Notch1 siRNA significantly (52%) decreased Notch1 mRNA expression in SVZ neurosphere cells compared with normal control neurosphere cells, and Notch1 expression was decreased by 46% compared with scrambled controls. There was no significant difference in scrambled controls compared with normal control neurosphere cells. Figure 5B shows that Notch1-KD in SVZ neurosphere cells decreased Notch1, NICD, and Hes1 expression compared with normal controls and attenuated atorvastatin-induced NICD and Hes1 expression. Scrambled neurospheres did not influence Notch1, NICD, and Hes1 expression compared with control neurospheres. Atorvastatin treatment in scrambled neurospheres increased NICD and Hes1 expression compared with untreated scrambled controls.
|
Ki67, a nuclear protein expressed in all phases of the cell cycle except the resting phase, is used as a marker of cell proliferation.22 To test whether Notch1-KD influences atorvastatin-induced neurosphere cell proliferation, Ki67 immunostaining and neurosphere formation were measured. Figures 5C through 5I show that atorvastatin treatment of normal or scrambled neurosphere cells significantly increased Ki67 expression compared with untreated normal or scrambled neurosphere cells. Notch1-KD in neurosphere cells significantly decreased Ki67-positive cell numbers compared with normal control neurosphere cells and scrambled controls. Notch1-KD in neurosphere cells and atorvastatin treatment significantly decreased Ki67-positive cell numbers compared with normal neurosphere cells treated with atorvastatin (P<0.05). In addition, owing to incomplete Notch1-KD (52% decrease), Ki67 expression was significantly decreased but not completely inhibited by Notch1-KD. These data suggest that the Notch1 signaling pathway may regulate atorvastatin-induced neurosphere cell proliferation.
| Discussion |
|---|
|
|
|---|
Atorvastatin Increases NPC Proliferation in Retired Breeder Rats
Neurogenesis, which contributes to the ability of the adult brain to function normally and to adapt to disease, declines with advancing age.23 Atorvastatin treatment increased BrdU incorporation in the ipsilateral SVZ after stroke, which is consistent with in vitro SVZ neurosphere culture data showing that atorvastatin promotes SVZ neurosphere formation and neural cell proliferation. This suggests that atorvastatin increases NPC proliferation and the NPC pool in retired breeder animals.
Atorvastatin Promotes Notch Signaling Activity
NSCs that reside in the adult brain are responsive to environmental demands and appear capable of replacing lost or dysfunctional neurons and glial cells, perhaps even in the aging brain.24 Atorvastatin induces SVZ neural cell proliferation in older brains after stroke and upregulates Notch1 activity (NICD) in the ischemic brain SVZ. Notch1 activation in the murine forebrain promotes radial glial identity. Radial glial cells may function as NPCs in the adult nervous system.25 In addition, Hes, which is expressed by NPCs, is controlled by the transmembrane protein Notch.26 Hes1 is a well-studied downstream target gene in the Notch signaling pathway, which is upregulated by overexpressed NICD.27 Overexpression of Notch1 and Hes1 promotes cell proliferation and self-renewal.28 Hes1- and Hes5-expressing cells are maintained as NSCs, and Hes1 and Hes5 increase NSC proliferation in the embryonic telencephalon but inhibit their differentiation.29 Disruption of Notch/Hes pathway genes results in the reduction of the NPC pool size.3 Our data show that atorvastatin increases activation of Notch1, upregulates Hes1 expression, and promotes neurosphere cell proliferation. Therefore, Notch signaling activity induced by atorvastatin treatment may play a role in enlarging the NPC pool in the retired breeder rat after stroke.
Atorvastatin Increases PS1 Expression in the Ischemic Brain
-Secretase activates Notch signaling,30 and PS1 is a critical component of the
-secretase complex, which cleaves several substrates, including the amyloid precursor protein and Notch1. Our data have shown atorvastatin increases PS1 and NICD expression and induces SVZ cell proliferation in vitro and in vivo. PS1-reactive cells colocalize with NICD-positive cells in the SVZ. Inhibition of
-secretase activity in cultured SVZ neurospheres attenuates atorvastatin-induced Notch1 signaling activity. Therefore, atorvastatin may upregulate PS1 expression, which promotes Notch1 signaling activity but does not influence Notch1 gene and protein expression. Consistent with our finding, in the ventricular zone of PS1–/– mice, expression of the Notch1 downstream effector gene Hes5 is reduced, whereas expression of Notch1 is unchanged.31 Disruption of Notch1 signaling by a
-secretase inhibitor or use of mice deficient in PS1 delays neurosphere formation.2,32 Therefore, atorvastatin upregulates PS1 and Notch1 signaling activity, which may partially influence NPC proliferation. In addition to atorvastatins upregulation of PS1 and Notch activity, previous studies have shown that statins increase vascular endothelial growth factor and brain-derived neurotrophic factor expression in the ischemic brain, which may also play important roles in regulating NPC proliferation, survival, and neurogenesis.13,15 Although using an in vitro model of SVZ cell culture is an oversimplification of the in vivo condition, it is possible to gain insight into basic biologic mechanisms of atorvastatin-induced endogenous cell proliferation in the SVZ. In addition, PS1-deficient mice exhibit premature differentiation of NPCs31 and increased oligodendroglial cell numbers compared with wild-type mice.33 Therefore, further experiments to test the effects of the atorvastatin-induced PS1/Notch1 pathway on cell fate decisions and neuronal differentiation are warranted.
In summary, we have demonstrated for the first time that atorvastatin increases PS1 expression, activates the Notch1/Hes1 pathway, and promotes NPC proliferation after stroke in retired breeder rats.
| Acknowledgments |
|---|
Sources of Funding
This work was supported by National Institute of Neurological Disorders and Stroke grants RO1 NS047682 and PO1 NS23393 and American Heart Association grant 0750048Z.
Disclosures
None.
Received April 10, 2007; revision received June 13, 2007; accepted June 18, 2007.
| References |
|---|
|
|
|---|
2. Chojnacki A, Shimazaki T, Gregg C, Weinmaster G, Weiss S. Glycoprotein 130 signaling regulates notch1 expression and activation in the self-renewal of mammalian forebrain neural stem cells. J Neurosci. 2003; 23: 1730–1741.
3. Hitoshi S, Alexson T, Tropepe V, Donoviel D, Elia AJ, Nye JS, Conlon RA, Mak TW, Bernstein A, van der Kooy D. Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells. Genes Dev. 2002; 16: 846–858.
4. Iso T, Kedes L, Hamamori Y. Hes and herp families: multiple effectors of the notch signaling pathway. J Cell Physiol. 2003; 194: 237–255.[CrossRef][Medline] [Order article via Infotrieve]
5. Solecki DJ, Liu XL, Tomoda T, Fang Y, Hatten ME. Activated notch2 signaling inhibits differentiation of cerebellar granule neuron precursors by maintaining proliferation. Neuron. 2001; 31: 557–568.[CrossRef][Medline] [Order article via Infotrieve]
6. Androutsellis-Theotokis A, Leker RR, Soldner F, Hoeppner DJ, Ravin R, Poser SW, Rueger MA, Bae SK, Kittappa R, McKay RD. Notch signalling regulates stem cell numbers in vitro and in vivo. Nature. 2006; 442: 823–826.[CrossRef][Medline] [Order article via Infotrieve]
7. Mason HA, Rakowiecki SM, Gridley T, Fishell G. Loss of notch activity in the developing central nervous system leads to increased cell death. Dev Neurosci. 2006; 28: 49–57.[CrossRef][Medline] [Order article via Infotrieve]
8. Mason HA, Rakowiecki SM, Raftopoulou M, Nery S, Huang Y, Gridley T, Fishell G. Notch signaling coordinates the patterning of striatal compartments. Development. 2005; 132: 4247–4258.
9. De Strooper B, Annaert W, Cupers P, Saftig P, Craessaerts K, Mumm JS, Schroeter EH, Schrijvers V, Wolfe MS, Ray WJ, Goate A, Kopan R. A presenilin-1-dependent
-secretase-like protease mediates release of notch intracellular domain. Nature. 1999; 398: 518–522.[CrossRef][Medline]
[Order article via Infotrieve]
10. Song W, Nadeau P, Yuan M, Yang X, Shen J, Yankner BA. Proteolytic release and nuclear translocation of notch-1 are induced by presenilin-1 and impaired by pathogenic presenilin-1 mutations. Proc Natl Acad Sci U S A. 1999; 96: 6959–6963.
11. Wines-Samuelson M, Shen J. Presenilins in the developing, adult, and aging cerebral cortex. Neuroscientist. 2005; 11: 441–451.
12. Kern A, Roempp B, Prager K, Walter J, Behl C. Down-regulation of endogenous amyloid precursor protein processing due to cellular aging. J Biol Chem. 2006; 281: 2405–2413.
13. Chen J, Zhang C, Jiang H, Li Y, Zhang L, Robin A, Katakowski M, Lu M, Chopp M. Atorvastatin induction of VEGF and BDNF promotes brain plasticity after stroke in mice. J Cereb Blood Flow Metab. 2005; 25: 281–290.[CrossRef][Medline] [Order article via Infotrieve]
14. Chen J, Zhang ZG, Li Y, Wang Y, Wang L, Jiang H, Zhang C, Lu M, Katakowski M, Feldkamp CS, Chopp M. Statins induce angiogenesis, neurogenesis, and synaptogenesis after stroke. Ann Neurol. 2003; 53: 743–751.[CrossRef][Medline] [Order article via Infotrieve]
15. Chen J, Zacharek A, Li A, Zhang C, Ding J, Roberts C, Lu M, Kapke A, Chopp M. Vascular endothelial growth factor mediates atorvastatin-induced mammalian achaete-scute homologue-1 gene expression and neuronal differentiation after stroke in retired breeder rats. Neuroscience. 2006; 141: 737–744.[CrossRef][Medline] [Order article via Infotrieve]
16. Li Y, Jiang N, Powers C, Chopp M. Neuronal damage and plasticity identified by microtubule-associated protein 2, growth-associated protein 43, and cyclin d1 immunoreactivity after focal cerebral ischemia in rats. Stroke. 1998; 29: 1972–1980; discussion 1980–1971.
17. Chen J, Zacharek A, Zhang C, Jiang H, Li Y, Roberts C, Lu M, Kapke A, Chopp M. Endothelial nitric oxide synthase regulates brain-derived neurotrophic factor expression and neurogenesis after stroke in mice. J Neurosci. 2005; 25: 2366–2375.
18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(–
C(T)) method. Methods. 2001; 25: 402–408.[CrossRef][Medline]
[Order article via Infotrieve]
19. Lah JJ, Heilman CJ, Nash NR, Rees HD, Yi H, Counts SE, Levey AI. Light and electron microscopic localization of presenilin-1 in primate brain. J Neurosci. 1997; 17: 1971–1980.
20. Ray WJ, Yao M, Mumm J, Schroeter EH, Saftig P, Wolfe M, Selkoe DJ, Kopan R, Goate AM. Cell surface presenilin-1 participates in the
-secretase-like proteolysis of notch. J Biol Chem. 1999; 274: 36801–36807.
21. Iso T, Sartorelli V, Chung G, Shichinohe T, Kedes L, Hamamori Y. Herp, a new primary target of notch regulated by ligand binding. Mol Cell Biol. 2001; 21: 6071–6079.
22. Kee N, Sivalingam S, Boonstra R, Wojtowicz JM. The utility of Ki-67 and BrdU as proliferative markers of adult neurogenesis. J Neurosci Methods. 2002; 115: 97–105.[CrossRef][Medline] [Order article via Infotrieve]
23. Cameron HA, McKay RD. Restoring production of hippocampal neurons in old age. Nat Neurosci. 1999; 2: 894–897.[CrossRef][Medline] [Order article via Infotrieve]
24. Mattson MP, Duan W, Chan SL, Cheng A, Haughey N, Gary DS, Guo Z, Lee J, Furukawa K. Neuroprotective and neurorestorative signal transduction mechanisms in brain aging: modification by genes, diet and behavior. Neurobiol Aging. 2002; 23: 695–705.[CrossRef][Medline] [Order article via Infotrieve]
25. Fishell G, Kriegstein AR. Neurons from radial glia: the consequences of asymmetric inheritance. Curr Opin Neurobiol. 2003; 13: 34–41.[CrossRef][Medline] [Order article via Infotrieve]
26. Kageyama R, Ohtsuka T, Tomita K. The bhlh gene hes1 regulates differentiation of multiple cell types. Mol Cells. 2000; 10: 1–7.[CrossRef][Medline] [Order article via Infotrieve]
27. Yan B, Raben N, Plotz P. The human acid
-glucosidase gene is a novel target of the notch-1/hes-1 signaling pathway. J Biol Chem. 2002; 277: 29760–29764.
28. Ross SE, Greenberg ME, Stiles CD. Basic helix-loop-helix factors in cortical development. Neuron. 2003; 39: 13–25.[CrossRef][Medline] [Order article via Infotrieve]
29. Ohtsuka T, Sakamoto M, Guillemot F, Kageyama R. Roles of the basic helix-loop-helix genes hes1 and hes5 in expansion of neural stem cells of the developing brain. J Biol Chem. 2001; 276: 30467–30474.
30. Martys-Zage JL, Kim SH, Berechid B, Bingham SJ, Chu S, Sklar J, Nye J, Sisodia SS. Requirement for presenilin 1 in facilitating lagged 2-mediated endoproteolysis and signaling of notch 1. J Mol Neurosci. 2000; 15: 189–204.[CrossRef][Medline] [Order article via Infotrieve]
31. Handler M, Yang X, Shen J. Presenilin-1 regulates neuronal differentiation during neurogenesis. Development. 2000; 127: 2593–2606.[Abstract]
32. Alexson TO, Hitoshi S, Coles BL, Bernstein A, van der Kooy D. Notch signaling is required to maintain all neural stem cell populations–irrespective of spatial or temporal niche. Dev Neurosci. 2006; 28: 34–48.[CrossRef][Medline] [Order article via Infotrieve]
33. Culvenor JG, Rietze RL, Bartlett PF, Masters CL, Li QX. Oligodendrocytes from neural stem cells express
-synuclein: increased numbers from presenilin 1 deficient mice. Neuroreport. 2002; 13: 1305–1308.[CrossRef][Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
J. Xu, X. Liu, J. Chen, A. Zacharek, X. Cui, S. Savant-Bhonsale, Z. Liu, and M. Chopp Simvastatin enhances bone marrow stromal cell differentiation into endothelial cells via notch signaling pathway Am J Physiol Cell Physiol, March 1, 2009; 296(3): C535 - C543. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zacharek, J. Chen, X. Cui, Y. Yang, and M. Chopp Simvastatin Increases Notch Signaling Activity and Promotes Arteriogenesis After Stroke Stroke, January 1, 2009; 40(1): 254 - 260. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Stroke Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2008 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |