Donate Help Contact The AHA Sign In Home
American Heart Association
Stroke
Search: search_blue_button Advanced Search
Stroke. 2008;39:935-942
Published online before print February 7, 2008, doi: 10.1161/STROKEAHA.107.501460
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
39/3/935    most recent
STROKEAHA.107.501460v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cordeau, P.
Right arrow Articles by Kriz, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cordeau, P., Jr
Right arrow Articles by Kriz, J.
Related Collections
Right arrow Animal models of human disease
Right arrow Pathology of Stroke

(Stroke. 2008;39:935.)
© 2008 American Heart Association, Inc.


Original Contributions

Live Imaging of Neuroinflammation Reveals Sex and Estrogen Effects on Astrocyte Response to Ischemic Injury

Pierre Cordeau, Jr, BSc; Mélanie Lalancette-Hébert, MS; Yuan Cheng Weng, MS Jasna Kriz, MD, PhD

From the Department of Anatomy and Physiology, Laval University, Centre de Recherche du Centre Hospitalier de l’Université Laval, Quebec, Canada.

Correspondence to Jasna Kriz, MD, PhD, Department of Anatomy and Physiology, Faculty of Medicine, Centre de Recherche du CHUL, T3-67, Université Laval, 2705 Boulevard Laurier, Québec, Canada G1V 4G2. E-mail Jasna.Kriz{at}crchul.ulaval.ca


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background and Purpose— We sought to develop a model system for live analysis of brain inflammatory response in ischemic injury.

Methods— Using a reporter mouse-expressing luciferase gene under transcriptional control of the murine glial fibrillary acidic protein (GFAP) promoter (GFAP-luc mice) and biophotonic/bioluminescent imaging as tools, we developed a model system for in vivo analysis of astrocyte activation/response in cerebral ischemia.

Results— Analysis of photon emissions from the brains of living animals revealed marked sex differences in astrocyte response to ischemic injury. The increase in GFAP signals was significantly higher in female mice in the metestrus/diestrus period compared with male transgenic mice (1.71x107±0.19x107 vs 0.92x107±0.15x107, P<0.001). Similar results were obtained by quantitative immunohistochemistry (males vs females: 13.4±0.5 vs 16.96±0.64, P<0.0001). However, astrocyte activation/GFAP signals showed cyclic, estrus-dependent variations in response to ischemic injury. Physiologically higher levels of estrogen and application of pharmacologic doses of estrogen during replacement therapy attenuated GFAP upregulation after stroke. Interestingly, contrary to a positive correlation between the intensities of GFAP signals and infarct size in male mice, no such correlation was observed in any of the experimental groups of female GFAP-luc mice.

Conclusions— Our results suggest that GFAP upregulation in ischemic injury may have different functional significance in female and male experimental animals and may not directly reflect the extent of ischemia-induced neuronal damage in female GFAP-luc mice. Using a novel live imaging approach, we demonstrated that the early-phase brain inflammatory response to ischemia may be associated with sex-specific biomarkers of brain damage.


Key Words: estrogen • glial fibrillary acidic protein • focal ischemia • gliosis • inflammation • biophotonic/bioluminescent imaging • transgenic mice


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Reactive astrogliosis is 1 of the key components of the cellular response to brain injury, and the passage from quiescent to reactive astrocytes is associated with strong upregulation of the intermediate-filament, glial fibrillary acidic protein (GFAP).1–3 An increase in GFAP expression has been found to be a hallmark of many neurodegenerative conditions, such as Parkinson disease, Alzheimer disease,4,5 and amyotrophic lateral sclerosis.6,7 In cerebral ischemia, GFAP has been widely used as an alternative marker of neuronal damage.8–10

Recent studies of the GFAP-knockout mouse have suggested that the role of this intermediate-filament protein in brain injury may be more complex than previously thought.11 Contrary to expectations, an absence of GFAP protein has been associated with increased susceptibility to ischemic brain damage after middle cerebral artery occlusion (MCAO)12 and marked alterations in posttraumatic glial scarring and tissue healing.13 In cerebral ischemia, intensively stained GFAP-positive astrocytes accumulate in large numbers in the areas around the ischemic lesion. The functional significance of such an astrocytic response surrounding focal cerebral infarcts is still unclear.14,15 To further investigate the role of astrocyte response to ischemia, we took the advantage of GFAP-luc transgenic mice.16 In this mouse model, the luciferase gene (firefly luciferase, luc) is driven by the GFAP promoter, and luciferase expression (bioluminescence photon emission) can be followed longitudinally in live animals by biophotonic imaging and a high-resolution CCD camera.16,17

We report herein a marked sex difference in the astrocyte response to ischemic injury. Furthermore, our results suggest that the functional significance of postischemic GFAP upregulation may differ in female versus male mice.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Transgenic Mice
The transgenic GFAP-luc mice (FVB/N background and heterozygous for the luc gene) were obtained from Xenogen (Caliper Life Sciences, Hopkinton, Mass). In this mouse model, the luciferase reporter (firefly luciferase) is driven under transcriptional control of the 12-kb fragment of the murine GFAP promoter.16 The GFAP-luc transgenic mice were genotyped by polymerase chain reaction with the HotStar Taq Master Mix kit (Quiagen, Mississauga, Canada) in 15 mmol/L MgCl2 polymerase chain reaction buffer with the following primers: 5'GAAATGTCCGTTCGGTTGGCAGAAGC and 5' CCAAAACCGTGATGGAATGGAACAACA. The polymerase chain reaction conditions were as follows: 95°C for 15 minutes and 30 cycles of 94°C for 30 seconds, 65°C for 30 seconds, 72°C for 1 minute, and 72°C for 7 minutes. All experimental procedures were approved by the Laval University Animal Care Ethics Committee and are in accordance with the Guide to the Care and Use of Experimental Animals of the Canadian Council on Animal Care.

Surgical Procedures
As previously described,18,19 transient focal cerebral ischemia was induced by unilateral left MCAO. The surgery was performed on 2- to 3-month-old male and female GFAP-luc mice and their wild-type (FVB/N) littermates. Unilateral transient focal cerebral ischemia was induced by intraluminal filament occlusion of the left MCA with a 6-0 silicone-coated monofilament suture for 1 hour followed by reperfusion times of 24 and 72 hours, 5 and 7 days after surgery. To avoid cooling, body temperature was maintained at 37°C with a heating pad. All animals were allowed free access to water and food before and after surgery.

Ovariectomy (OVX) was performed on anesthetized female mice at 10 weeks of age by bilateral removal of the ovaries. MCAO was induced 14 and 40 days after OVX. To investigate the effects of estrogen replacement therapy, as previously described,20 1 group of OVX mice was anesthetized and subcutaneously implanted with a silicone elastomer implant of cholesterol/17β-estradiol, 100:1. The other group was sham operated. Seven days after surgery, the mice were subjected to MCAO and imaged at different time points after experimental ischemia.

Vaginal Smears and Hormone Detection
Vaginal epithelial cells were obtained from female mice and smeared onto precleaned slides. Slides were then evaluated for the presence of white blood cells and the morphology of epithelial cells to determine the stage of the estrus cycle. Estradiol (pg/mL) levels were determined from frozen serum samples and run in duplicate on a gas chromatograph/mass spectrometer. Estradiol levels were nondetectable in OVX mice (vs 119.03 pg/mL in OVX mice on estrogen therapy. (The lower limit of quantification for estradiol is 2 to 3 pg/mL.)

In Vivo Bioluminescence Imaging
The images were gathered with an IVIS 200 imaging system (Xenogen, Alameda, Calif). Before the imaging session, the mice received an injection of D-luciferin (150 mg/kg IP, Xenogen), a luciferase substrate, dissolved in 0.9% saline. The mice were then anesthetized with 2% isoflurane in 100% O2 at a flow rate of 2 L/min and placed in a heated, light-tight imaging chamber. Images were collected with a high-sensitivity CCD camera with wavelengths ranging from 300 to 600 nm. Exposure time for imaging was 1 to 2 minutes with different fields of views and an f/1 lens aperture. As previously described,17,19 bioluminescence emission was normalized and displayed in physical units of surface radiance (photons · s–1 · cm–2 · steradian–1 [sr]). Light output was quantified by determining the total number of photons emitted per second with the use of Living Image 2.5 acquisition and imaging software (Xenogen). Region-of-interest measurements on the images were used to convert surface radiance (photons · s–1 · cm–2 · sr–1) to source flux or the total flux of photons expressed in photons/second. The data are represented as pseudocolor images indicating light intensity (red and yellow, most intense), which were superimposed over gray-scale reference photographs. For acquisition of 3D images, we acquired gray-scale photographs and structured light images, followed by a series of bioluminescent images at different wavelengths (560 to 660 nm). Three-dimensional images were created with diffuse luminescent imaging tomography algorithms to reconstruct the position, geometry, and strength of the internal light sources. The modifiable parameters were analysis across wavelengths, source spectrum, and tissue properties (Living Image 3D Analysis Software, Xenogen).

Infarct Size
At day 8, mice were humanely killed by an overdose of anesthetic and transcardially perfused with phosphate buffer solution followed by 4% paraformaldehyde at pH 7.4. The brains were then cut into 35-µm-thick slices and stained with cresyl violet histologic stain.21 Infarct volume (mm3) was calculated for each section of brain and quantified by using the Neurolucida program (MBF Bioscience, Williston, Vt). Approximately 150 sections were analyzed per brain per mouse. Nine to 15 mice were used for each experimental group.

Immunocytochemistry and Tissue Collection
The animals were anesthetized and transcardially perfused with phosphate buffer solution followed by 4% paraformaldehyde at pH 7.4. Tissue sample were postfixed overnight in 4% paraformaldehyde and then cryopreserved in phosphate-buffered 30% sucrose. As previously described,19 immunofluorescence was performed as follows. Thirty-five-micron brain sections were blocked in Tris-buffered saline containing 5% goat serum and 0.20% Triton X-100 for 30 minutes. The sections were then incubated overnight at room temperature in a primary mouse monoclonal anti-GFAP antibody (Sigma, Oakville, Canada), followed by incubation with fluorescent goat Alexa Fluor 488 secondary antiserum (Invitrogen, Eugene, Ore). GFAP immunoreactivity was quantified with the Metamorph Imaging System by measuring the intensity of fluorescence per unit of surface area (arbitrary units). Ten sections per mouse were used for this analysis. For Figure 3, the data were averaged and analyzed by a Mann–Whitney test.

Statistical Analysis
All data are presented as mean±SEM. Statistical analysis was performed by 1-way ANOVA followed by a post hoc comparison test (Bonferroni test). P≤0.05 was considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Real-Time Imaging Reveals Estrogen-Dependent Modulation of GFAP Signals in Female Mice
Astrocyte response to ischemic injury in live animals was studied in GFAP-luc mice. Previous work by Zhu and colleagues16 demonstrated that an increase in GFAP signal is correlated with astrogliosis in GFAP-luc mice. As shown in Figure 1, the animals were imaged 24 and 72 hours and the 5 and 7 days after surgery. A robust signal arising from the ischemic part of the brain was detected in all animals subjected to MCAO. The intensity of the signal peaked at 24 and 72 hours and showed a decline at days 5 and 7 (Figure 1, A–L). Our preliminary analysis revealed that photon emission from the ischemic part of the brain was not detectable on day 0, 6 to 8 hours after surgery (data not shown). To our surprise, statistical analysis revealed that the signal intensities of total photon emission per second of the GFAP signals in the first 24 to 72 hours were significantly higher in female mice when they were out of estrus compared with male, age-matched littermates (24 hours after MCAO: metestrus/diestrus [M/D] females vs males, 1.708x107±0.192x107 vs 0.9170x 107±0.151x107; P<0.001, n=7 to 9; 72 hours after MCAO: M/D females vs males, 1.243x107±0.145x107 vs 0.362x 107±0.0357x107; P<0.001, n=7 to 9; Figure 1M). To investigate whether cyclic changes in estrogen levels have an effect on astrocyte response to injury, we monitored vaginal smears daily to determine the stage of the estrus cycle. In addition, to further confirm the effects of higher levels of estrogen on astrocyte activation, we investigated GFAP signal induction after stroke in mice treated with pharmacologic doses of estrogen (replacement therapy). Compared with female mice in M/D, the female mice in estrus and the OVX mice on estrogen replacement therapy (pharmacologic doses) showed a significant decrease in GFAP signal induction after stroke. At 24 hours after MCAO, the values were OVX+estrogen, 0.362x107±0.036x107; at 72 hours after MCAO, the corresponding value was 0.327x107±0.562x107 (n=7; Figure 1M).


Figure 1501460
View larger version (58K):
[in this window]
[in a new window]

 
Figure 1. Real-time visualization of bioluminescent GFAP signals after cerebral ischemia. Representative images of male (A–D), female in M/D (E–H), and female in P/E (I–L) GFAP-luc mice imaged at 24 and 72 hours for 5 and 7 days after 60 minutes of MCAO. The images were longitudinally recorded from the same experimental animal and reveal the dynamics of astrocyte activation throughout the 7 days. Scales on the right are the color maps for photon counts. M, Quantification of luciferase signals by LivingImage software (Xenogen) revealed a higher GFAP signal induction in female M/D mice.

Spatiotemporal Distribution of Bioluminescent Signals in GFAP-luc Mice Is Correlated With GFAP Immunoreactivity
To determine whether photons detected by the CCD camera after cerebral ischemia were being emitted from the appropriate brain regions, we performed a 3D reconstruction of the recorded signals. In transient MCAO, 2 to 3 days after reperfusion, intensively stained GFAP-positive astrocytes are situated in the areas surrounding the ischemic lesion.14,18 A 3D reconstruction of the imaging samples (by diffuse luminescent imaging tomography) at 6 wavelengths (560 to 660 nm) across the emission spectrum of the source (Figure 2, A–F), revealed that the areas of highest photon-emission density (red and brown rectangles) were indeed situated in the areas surrounding the site of the ischemic lesion (Figure 2, G and H). Because our imaging data revealed a significant difference in GFAP signals 24 to 72 hours after stroke (7 days of longitudinal imaging), we investigated whether our in vivo imaging results could be confirmed by immunocytochemistry. Consistent with the bioluminescent signal data, 72 hours after transient MCAO ischemic/reperfusion, injury was characterized by a robust increase in GFAP immunoreactivity in the areas at the periphery of the ischemic lesion (Figure 3, A–C). Further analysis of high-magnification photomicrographs revealed that GFAP-labeled astrocytes in female mice displayed a more ramified morphology than did GFAP-positive astrocytes surrounding the ischemic lesion in male mice (Figure 3, B–D) suggesting a higher activation state of the astrocytes.22 Quantitative analysis of immunofluorescent labeling in the brain sections of poststroke mice revealed a significant increase in GFAP immunoreactivity in the female compared with male mice (male, 13.40±0.55, n=7; female, 16.96±0.64, n=9; P<0.0001, Figure 3E).


Figure 2501460
View larger version (58K):
[in this window]
[in a new window]

 
Figure 2. Three-dimensional reconstruction of bioluminescent signals emitted from the brains of poststroke GFAP-luc mice 72 hours after MCAO. A–F, Representative images show sample collection at 6 different wavelengths across the emission spectrum of the bioluminescent source, with a substantial fraction of the light at 600 nm (D and E). With the use of diffuse luminescent imaging tomography algorithms and structural images (Living Image 3D software, Xenogen), the data were transformed to 3D images (G and H). Red and brown rectangles (concentrated around the predicted ischemic lesion) represent areas of the brain with the highest intensity of photon emission. Localization of the highest-intensity area was measured and presented along 3 axes (x, y, and z) in millimeters from the skull surface (small panels on the left, G and H). Scales on the right are the color maps for photon density and source intensity.


Figure 3501460
View larger version (42K):
[in this window]
[in a new window]

 
Figure 3. Representative photomicrographs of male and female GFAP-stained brain sections 72 hours after MCAO. Immunofluorescence labeling showed higher GFAP immunoreactivity in areas at the periphery of the ischemic lesion (A and C). Higher-magnification photomicrographs revealed a more ramified morphology of activated astrocytes in female compared with male mice (B and D). Densitometry quantification revealed significantly higher levels of GFAP expression in the brain sections of female mice (males, 13.40±0.55, n=7; females, 16.96±0.64, n=9; P<0.0001). Scale bars=500 µm for A and C, 50 µm for B and D.

Chronic Lack of Estrogen Increases Astrocyte Response to Ischemic Injury in Female Mice
Because physiologically and pharmacologically higher doses of estrogen attenuated GFAP upregulation, we hypothesized that a lack of estrogen in females should then be associated with a higher GFAP signal induction in response to cerebral ischemia. Therefore, the same experimental protocol was performed in OVX mice. To our surprise, the signal intensities after brain ischemia in OVX GFAP-luc mice when MCAO was performed 14 days after OVX were significantly smaller compared with intact female littermates out of estrus (Figure 4). However, when MCAO was performed 40 days after OVX, we observed a significant increase in astrocyte response (GFAP upregulation) to ischemic injury, suggesting that chronic estrogen deprivation may change astrocyte activation and inflammatory response in the brain (Figure 4).


Figure 4501460
View larger version (26K):
[in this window]
[in a new window]

 
Figure 4. Histograms represent total photon emission (quantification of GFAP signals) measured in GFAP-luc mice after 60 minutes of MCAO and at40 (OVX 40 days) and 14 days (OVX 14 days) of estrogens deprivation. A higher GFAP induction signal was observed in the experimental group, OVX 40 days, at 24 and 72 hours (24 hours, OVX 40 days vs OVX 14 days: 1.214x107±0.165x107 vs 0.457x107±0.095x107; 72 hours: 1.83x107±0.38x107 vs 0.545x107±0.014x107, n=5).

GFAP Upregulation in Cerebral Ischemia Is Differentially Correlated With Neuronal Damage in Male and Female Mice
Previous reports revealed a strong correlation between the increase in GFAP levels and neuronal damage in cerebral ischemia.23 Thus, one can potentially predict the severity of the ischemic lesion on the basis of the intensity of detected GFAP signals. Because in our experiments we observed a different astrocyte response in female and male mice, we wanted to investigate whether GFAP upregulation would be a good biomarker and predictor of ischemic injury in both sexes. As shown in Figure 5A, quantitative analysis of cresyl violet–stained brain sections (at the end of the imaging protocols) revealed that the size of the ischemic lesion was in general significantly higher in male compared with female mice (males, 12.11±1.361, n=7; M/D females, 8.366±1.522, n=5; proestrus/estrus [P/E)] females, 5.295±0.900, n=6; OVX at 14 days, 10.25±1.706, n=7; OVX+estrogen, 4.598±0.970, n=5; males versus P/E females, P=0.0004; males vs OVX+estrogen, P=0.0003). In addition, female GFAP-luc mice in estrus and OVX mice on high-dose estrogen therapy had significantly smaller lesions compared with other experimental groups. Furthermore, we investigated the correlation between the levels of photon emission/GFAP signal induction and infarct size. In all experimental protocols, the same animal was imaged for 7 days, and stroke area was measured at the end of the experimental protocol on day 8. As demonstrated in Figure 5B, bioluminescence signal intensities in GFAP-luc male mice showed a positive correlation with the size of the ischemic lesion (r2=0.5427; P=0.0063). To our surprise, contrary to the findings in male mice, no correlation between bioluminescent signal intensity/GFAP induction and infarct size was observed in any of the experimental groups of female GFAP-luc mice (Figure 5, C–F). Interestingly, although the intensities of photon emission/GFAP signal induction differed within the different groups of female GFAP-luc mice, depending on the levels of estrogen, GFAP signal induction/astrocyte activation was not a good predictor of ischemic injury in any of the experimental groups of female mice.


Figure 5501460
View larger version (24K):
[in this window]
[in a new window]

 
Figure 5. The histogram represents the size (volume) of the ischemic lesion in (mm3) measured 8 days after 60 minutes of MCAO (A). Ischemic lesions were significantly smaller in P/E, OVX, and OVX+estradiol mice compared with males. B, Correlation analysis between lesion size and GFAP intensity signals revealed a positive correlation in male GFAP-luc mice, whereas no such correlation was observed in female M/D (C), P/E (D), OVX (E), and OVX+estradiol (F) GFAP-luc mice (D). Note that at day 8, after 60 minutes of transient MCAO, the ischemic lesions were generally small, because spontaneous recovery processes had already been initiated.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
We report here a novel live imaging approach to study astrocyte response to ischemic injury in the brains of living mice. Our results revealed marked effects of sex and estrogen on astrocyte response to ischemic injury. We report here that: (1) bioluminescent signal intensities/GFAP induction were significantly higher in female mice (out of estrus) compared with males (confirmed by immunohistochemistry); (2) in female mice, astrocyte response to ischemia/GFAP upregulation was strongly dependent on the estrus cycle and serum estrogen level; and (3) contrary to the findings in male mice, there was no correlation between bioluminescent signal intensity/GFAP upregulation and size of the ischemic lesion in female GFAP-luc mice.

GFAP is a 50-kDa intermediate filament, predominantly expressed by mature astrocytes in the central nervous system.24,25 Reactive astrogliosis is a key component of the inflammatory cellular response to central nervous system injury, including ischemia.2,26 It is characterized by astrocyte hypertrophy and hyperplasia and the strong transcriptional upregulation of GFAP expression.3,26 The astrocyte activation after brain ischemia is initiated within the first few days and may persist up to 7 days (or longer) after stroke.27,28This concept was confirmed by our live imaging results, suggesting that the GFAP-luc mouse represents a reliable model system for in vivo analysis of astrocyte response to ischemic injury (Figures 3 and 4Up).

At present, little is known about estrogen modulation of astrocyte activation/GFAP upregulation in cerebral ischemia. Analysis of in vivo GFAP signals in our experiments showed that photon emissions 24 to 72 hours after stroke were significantly higher in female compared with male GFAP-luc mice. (Similar differences in GFAP activation were confirmed by immunohistochemistry.) Importantly, this finding changed when female mice entered estrus and/or when they were administered a high pharmacologic dose of estrogen, suggesting that estrogen may affect astrocyte response (ie, GFAP upregulation) to ischemic injury. This is in agreement with a recent report from Martinez and de Lacalle,29 who demonstrated a direct influence of gonadal hormones on the morphology and functional response of glial cells, particularly astrocytes, to brain injury.

The question that arises here is what are the possible explanations for this estrogen-dependent astrocytes response to ischemic injury? Previous studies of noninjured astrocytes demonstrated cyclic, estrus-dependent variations in GFAP expression in certain nuclei of the rat brain.30–32 In addition, a putative estrogen-responsive element binding site has been detected in the 5'-upstream region of the human and rat GFAP promoter,33 thus suggesting that the level of circulating gonadal hormones would predict or modulate the glial response to brain injury. The importance of gonadal hormones in the modulation of astrocyte response to injury was further confirmed in our hormone-deprivation experiments. At the early time point after OVX, we did not observe an increase in astrocyte response after MCAO, which may in part be explained by compensatory mechanisms and/or higher P450 aromatase activity in astrocytes34 as a source of nongonadal estrogens. In contrast, chronic deprivation of gonadal hormones was associated with a strong increase in astrocyte response to ischemia. A similar time course of astrocyte responsiveness to injury in OVX mice was observed by McAsey et al.35

However, the most striking result that emerged from our live imaging study was the marked sex difference in astrocyte response to cerebral ischemia. Although a sex effect is a known factor in stroke studies, previous reports have mostly focused on the direct neuroprotective effects of estrogens.36–39 For example, physiologic levels of estrogens have been shown to confer neuroprotection against stroke-related injury in young and middle-aged rats.37,40 Conversely, treatment with estrogen receptor antagonists exacerbated ischemic injury in female mice.41 In addition, a recent study demonstrated that estradiol treatment after cerebral ischemia enhanced neurogenesis.39 Our results are in line with previous evidence: namely, that ischemic lesions were generally smaller in female mice than in GFAP-luc males. Moreover, the infarcts were significantly smaller in females during estrus and in the females on estrogen replacement therapy (pharmacologic doses), thus confirming a direct neuroprotective effect of estrogen in ischemia (Figure 5A). However, contrary to the findings in male mice, where a positive correlation was observed between bioluminescent signal intensities/GFAP upregulation and infarct size, there was no correlation between GFAP upregulation/astrocyte response and infarct size in any of the experimental groups of female GFAP-luc mice, thus suggesting that GFAP upregulation/astrocyte response to ischemic injury may not have the same functional significance in male and female mice.

In conclusion, our results revealed marked sex and estrogen effects on astrocyte response to ischemic injury. In addition, the results of our study revealed that GFAP upregulation may have a different functional significance in female and male experimental animals and may not directly reflect the extent of ischemic brain damage in female GFAP-luc mice. Using a novel live imaging approach, we demonstrated that the early-phase inflammatory response in ischemia may be associated with sex-specific injury markers.


*    Acknowledgments
 
We thank G. Soucy for technical help in the estrogen replacement experiments.

Source of Funding

This work was supported by the Canadian Institutes of Health Research (CIHR) and the Quebec Transgenic Research Network. J.K. is a recipient of a career award from the R&D/Health Research Foundation and CIHR. M.L.-H. is a recipient of CIHR Canada Doctoral Scholarships.

Disclosures

None.


*    Footnotes
 
The first 2 authors equally contributed to this work.

Received August 7, 2007; accepted August 9, 2007.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Ridet JL, Malhotra SK, Privat A, Gage FH. Reactive astrocytes: cellular and molecular cues to biological function. Trends Neurosci. 1997; 20: 570–577.[CrossRef][Medline] [Order article via Infotrieve]

2. Stoll G, Jander S, Schroeter M. Inflammation and glial responses in ischemic brain lesions. Prog Neurobiol. 1998; 56: 149–171.[CrossRef][Medline] [Order article via Infotrieve]

3. Pekny M, Nilsson M. Astrocyte activation and reactive gliosis. Glia. 2005; 50: 427–434.[CrossRef][Medline] [Order article via Infotrieve]

4. Schneider JS, Denaro FJ. Astrocytic responses to the dopaminergic neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) in cat and mouse brain. J Neuropathol Exp Neurol. 1988; 47: 452–458.[Medline] [Order article via Infotrieve]

5. Nagele RG, Wegiel J, Venkataraman V, Imaki H, Wang KC, Wegiel J. Contribution of glial cells to the development of amyloid plaques in Alzheimer’s disease. Neurobiol Aging. 2004; 25: 663–674.[CrossRef][Medline] [Order article via Infotrieve]

6. Almer G, Vukosavic S, Romero N, Przedborski S. Inducible nitric oxide synthase up-regulation in a transgenic mouse model of familial amyotrophic lateral sclerosis. J Neurochem. 1999; 72: 2415–2425.[CrossRef][Medline] [Order article via Infotrieve]

7. Kriz J, Gowing G, Julien JP. Efficient three-drug cocktail for disease induced by mutant superoxide dismutase. Ann Neurol. 2003; 53: 429–436.[CrossRef][Medline] [Order article via Infotrieve]

8. Herrmann M, Ehrenreich H. Brain derived proteins as markers of acute stroke: their relation to pathophysiology, outcome prediction and neuroprotective drug monitoring. Restor Neurol Neurosci. 2003; 21: 177–190.[Medline] [Order article via Infotrieve]

9. Vissers JL, Mersch ME, Rosmalen CF, van Heumen MJ, van Geel WJ, Lamers KJ, Rosmalen FM, Swinkels LM, Thomsen J, Herrmann M. Rapid immunoassay for the determination of glial fibrillary acidic protein (GFAP) in serum. Clin Chim Acta. 2006; 366: 336–340.[CrossRef][Medline] [Order article via Infotrieve]

10. Petzold A, Keir G, Kerr M, Kay A, Kitchen N, Smith M, Thompson EJ. Early identification of secondary brain damage in subarachnoid hemorrhage: a role for glial fibrillary acidic protein. J Neurotrauma. 2006; 23: 1179–1184.[CrossRef][Medline] [Order article via Infotrieve]

11. Pekny M. Astrocytic intermediate filaments: lessons from GFAP and vimentin knock-out mice. Prog Brain Res. 2001; 132: 23–30.[Medline] [Order article via Infotrieve]

12. Nawashiro H, Messing A, Azzam N, Brenner M. Mice lacking GFAP are hypersensitive to traumatic cerebrospinal injury. Neuroreport. 1998; 9: 1691–1696.[Medline] [Order article via Infotrieve]

13. Pekny M, Johansson CB, Eliasson C, Stakeberg J, Wallen A, Perlmann T, Lendahl U, Betsholtz C, Berthold CH, Frisen J. Abnormal reaction to central nervous system injury in mice lacking glial fibrillary acidic protein and vimentin. J Cell Biol. 1999; 145: 503–514.[Abstract/Free Full Text]

14. Chen H, Chopp M, Schultz L, Bodzin G, Garcia JH. Sequential neuronal and astrocytic changes after transient middle cerebral artery occlusion in the rat. J Neurol Sci. 1993; 118: 109–106.[CrossRef][Medline] [Order article via Infotrieve]

15. Li Y, Chopp M, Zhang ZG, Zhang RL. Expression of glial fibrillary acidic protein in areas of focal cerebral ischemia accompanies neuronal expression of 72-kDa heat shock protein. J Neurol Sci. 1995; 128: 134–142.[CrossRef][Medline] [Order article via Infotrieve]

16. Zhu L, Ramboz S, Hewitt D, Boring L, Grass DS, Purchio AF. Non-invasive imaging of GFAP expression after neuronal damage in mice. Neurosci Lett. 2004; 367: 210–212.[CrossRef][Medline] [Order article via Infotrieve]

17. Maysinger D, Behrendt M, Lalancette-Hebert M, Kriz J. Real-time imaging of astrocyte response to quantum dots: in vivo screening model system for biocompatibility of nanoparticles. Nano Lett. 2007; 7: 2513–2520.[CrossRef][Medline] [Order article via Infotrieve]

18. Weng YC, Kriz J. Differential neuroprotective effects of a minocycline-based drug cocktail in transient and permanent focal cerebral ischemia. Exp Neurol. 2007; 204: 433–442.[CrossRef][Medline] [Order article via Infotrieve]

19. Lalancette-Hebert M, Gowing G, Simard A, Weng YC, Kriz J. Selective ablation of proliferating microglial cells exacerbates ischemic injury in the brain. J Neurosci. 2007; 27: 2596–2605.[Abstract/Free Full Text]

20. Soucy G, Boivin G, Labrie F, Rivest S. Estradiol is required for a proper immune response to bacterial and viral pathogens in the female brain. J Immunol. 2005; 174: 6391–6398.[Abstract/Free Full Text]

21. Tureyen K, Vemuganti R, Sailor KA, Dempsey RJ. Infarct volume quantification in mouse focal cerebral ischemia: a comparison of triphenyltetrazolium chloride and cresyl violet staining techniques. J Neurosci Methods. 2004; 139: 203–207.[CrossRef][Medline] [Order article via Infotrieve]

22. Wilhelmsson U, Bushong EA, Price DL, Smarr BL, Phung V, Terada M, Ellisman MH, Pekny M. Redefining the concept of reactive astrocytes as cells that remain within their unique domains upon reaction to injury. Proc Natl Acad Sci U S A. 2006; 103: 17513–17518.[Abstract/Free Full Text]

23. Herrmann M, Vos P, Wunderlich MT, de Bruijn CH, Lamers KJ. Release of glial tissue-specific proteins after acute stroke: a comparative analysis of serum concentrations of protein S-100B and glial fibrillary acidic protein. Stroke. 2000; 31: 2670–2677.[Abstract/Free Full Text]

24. Eng LF, Ghirnikar RS, Lee YL. Glial fibrillary acidic protein: GFAP thirty-one years (1969–2000). Neurochem Res. 2000; 25: 1439–1451.[CrossRef][Medline] [Order article via Infotrieve]

25. Herrmann H, Aebi U. Intermediate filaments: molecular structure, assembly mechanism, and integration into functionally distinct intracellular scaffolds. Annu Rev Biochem. 2004; 73: 749–789.[CrossRef][Medline] [Order article via Infotrieve]

26. Clark RK, Lee EV, Fish CJ, White RF, Price WJ, Jonak ZL, Feuerstein GZ, Barone FC. Development of tissue damage, inflammation and resolution following stroke: an immunohistochemical and quantitative planimetric study. Brain Res Bull. 1993; 31: 565–572.[CrossRef][Medline] [Order article via Infotrieve]

27. Dirnagl U, Iadecola C, Moskowitz MA. Pathobiology of ischaemic stroke: an integrated view. Trends Neurosci. 1999; 22: 391–397.[CrossRef][Medline] [Order article via Infotrieve]

28. Stoll G, Jander S. The role of microglia and macrophages in the pathophysiology of the CNS. Prog Neurobiol. 1999; 58: 233–247.[CrossRef][Medline] [Order article via Infotrieve]

29. Martinez L, de Lacalle S. Astrocytic reaction to a lesion, under hormonal deprivation. Neurosci Lett. 2007; 415: 190–193.[CrossRef][Medline] [Order article via Infotrieve]

30. Garcia-Segura LM, Chowen JA, Parducz A, Naftolin F. Gonadal hormones as promoters of structural synaptic plasticity: cellular mechanisms. Prog Neurobiol. 1994; 44: 279–307.[CrossRef][Medline] [Order article via Infotrieve]

31. Kohama SG, Bethea CL. Steroid regulation of tyrosine hydroxylase messenger ribonucleic acid in dopaminergic subpopulations of monkey hypothalamus. Endocrinology. 1995; 136: 1790–1800.[Abstract]

32. Stone DJ, Rozovsky I, Morgan TE, Anderson CP, Finch CE. Increased synaptic sprouting in response to estrogen via an apolipoprotein e-dependent mechanism: implications for Alzheimer’s disease. J Neurosci. 1998; 18: 3180–3185.[Abstract/Free Full Text]

33. Laping NJ, Teter B, Nichols NR, Rozovsky I, Finch CE. Glial fibrillary acidic protein: regulation by hormones, cytokines, and growth factors. Brain Pathol. 1994; 4: 259–275.[Medline] [Order article via Infotrieve]

34. Liu M, Hurn PD, Roselli CE, Alkayed NJ. Role of P450 aromatase in sex-specific astrocytic cell death. J Cereb Blood Flow Metab. 2007; 27: 135–141.[CrossRef][Medline] [Order article via Infotrieve]

35. McAsey ME, Cady C, Jackson LM, Li M, Randall S, Nathan BP, Struble RG. Time course of response to estradiol replacement in ovariectomized mice: brain apolipoprotein E and synaptophysin transiently increase and glial fibrillary acidic protein is suppressed. Exp Neurol. 2006; 197: 197–205.[Medline] [Order article via Infotrieve]

36. Rusa R, Alkayed NJ, Crain BJ, Traystman RJ, Kimes AS, London ED, Klaus JA, Hurn PD. 17β-estradiol reduces stroke injury in estrogen-deficient female animals. Stroke. 1999; 30: 1665–1670.[Abstract/Free Full Text]

37. Dubal DB, Wise PM. Neuroprotective effects of estradiol in middle-aged female rats. Endocrinology. 2001; 142: 43–48.[Abstract/Free Full Text]

38. McCullough LD, Hurn PD. Estrogen and ischemic neuroprotection: an integrated view. Trends Endocrinol Metab. 2003; 14: 228–235.[CrossRef][Medline] [Order article via Infotrieve]

39. Suzuki T, Shimizu T, Yu HP, Hsieh YC, Choudhry MA, Schwacha MG, Chaudry IH. Tissue compartment-specific role of estrogen receptor subtypes in immune cell cytokine production following trauma-hemorrhage. J Appl Physiol. 2007; 102: 163–168.[Abstract/Free Full Text]

40. Dubal DB, Zhu H, Yu J, Rau SW, Shughrue PJ, Merchenthaler I, Kindy MS, Wise PM. Estrogen receptor {alpha}, not β, is a critical link in estradiol-mediated protection against brain injury. Proc Natl Acad Sci U S A. 2001; 98: 1952–1957.[Abstract/Free Full Text]

41. Sawada M, Alkayed NJ, Goto S, Crain BJ, Traystman RJ, Shaivitz A, Nelson RJ, Hurn PD. Estrogen receptor antagonist ICI182,780 exacerbates ischemic injury in female mouse. J Cereb Blood Flow Metab. 2000; 20: 112–118.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
BrainHome page
M. Lalancette-Hebert, D. Phaneuf, G. Soucy, Y. C. Weng, and J. Kriz
Live imaging of Toll-like receptor 2 response in cerebral ischaemia reveals a role of olfactory bulb microglia as modulators of inflammation
Brain, April 1, 2009; 132(4): 940 - 954.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
39/3/935    most recent
STROKEAHA.107.501460v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cordeau, P.
Right arrow Articles by Kriz, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cordeau, P., Jr
Right arrow Articles by Kriz, J.
Related Collections
Right arrow Animal models of human disease
Right arrow Pathology of Stroke