| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Stroke. 2008;39:2129.)
© 2008 American Heart Association, Inc.
Original Contributions |
B After Neonatal Hypoxia-Ischemia Involves Apoptotic Mechanisms but Is Independent of CytokinesFrom the Laboratory of Psychoneuroimmunology (C.H.A.N., C.J.H., A.K.) and the Department of Neonatology (C.H.A.N., F.G., F.v.B.), University Medical Center Utrecht, The Netherlands; and the Department of Animal Biology (M.J.M.), University of Pennsylvania, School of Veterinary Medicine, Philadelphia.
Correspondence to Cobi J. Heijnen, University Medical Center Utrecht, Laboratory of Psychoneuroimmunology, Lundlaan 6, KC 03.068.0, 3584 EA Utrecht, The Netherlands. E-mail C.Heijnen{at}umcutrecht.nl
| Abstract |
|---|
|
|
|---|
B has been suggested to enhance brain damage via stimulation of cytokine production. There is also evidence that NF-
B activity is required for neuronal survival. We used the NF-
B inhibitor NBD, coupled to TAT to facilitate cerebral uptake, to determine the neuroprotective capacity of NF-
B inhibition in neonatal hypoxia-ischemia (HI) and to identify its contribution to cerebral inflammation and damage.
Methods— Brain damage was induced in neonatal rats by unilateral carotid artery occlusion and hypoxia and analyzed immunohistochemically; NF-
B activity was analyzed by EMSA. We analyzed cytokine mRNA levels and activation of apoptotic pathways by Western blotting. In vitro effects of TAT-NBD were determined in a neuronal cell line.
Results— Inhibition of cerebral NF-
B activity by TAT-NBD had a significant neuroprotective effect; brain damage was reduced by more than 80% with a therapeutic window of at least 6 hours. In contrast to earlier suggestions, the protective effect of TAT-NBD did not involve suppression of early cytokine upregulation after HI. Moreover, NF-
B inhibition prevented HI-induced upregulation and nuclear as well as mitochondrial accumulation of p53, prevented mitochondrial cytochrome-c release and activation of caspase-3. Finally, TAT-NBD could directly increase neuronal survival because TAT-NBD was sufficient to inhibit death in a neuronal cell line. A nonactive mutant peptide did not have any effect.
Conclusions— Inhibition of NF-
B has strong neuroprotective effects that involve downregulation of apoptotic molecules but are independent of inhibition of cytokine production.
Key Words: nuclear factor–kappa-B inflammation neonatal neuroprotection
| Introduction |
|---|
|
|
|---|
Nuclear factor kappa B (NF-
B) is a ubiquitously expressed transcription factor that regulates expression of genes involved in inflammation, cell survival, and apoptosis.3,4 In resting cells, NF-
B is sequestered in the cytoplasm by binding to inhibitory I
B proteins typified by I
B
. Signal-induced phosphorylation of I
B
by a high molecular-weight complex of proteins named the I
B-kinase (IKK)-complex is a key step in NF-
B activation. The IKK complex consists of 2 kinases, IKK
and IKKβ, and the regulatory protein NEMO (NF-
B essential modulator). Phosphorylated I
B
becomes ubiquitinated and is proteasome-degraded after which free NF-
B enters the nucleus to regulate transcription.4,5
NF-
B activation has been described in various in vivo and in vitro models of brain injury (reviewed in 6), but its role in cerebral damage is complex as it functions in both protective and damaging pathways. In neurons, NF-
B supports survival by increasing the expression of antioxidants, growth factors, and antiapoptotic molecules. However, NF-
B also upregulates expression of proapoptotic factors such as p53.7–9 Reciprocal interaction between proapoptotic activity of p53 and antiapoptotic signals provided by NF-
B further complicate the prediction of the effect of NF-
B activity on brain damage. Finally, glial NF-
B activation induces production of proinflammatory cytokines, a pathway proposed to promote neuronal death in vivo.10
Previous studies investigating the role of NF-
B in cerebral damage have used either nonselective pharmacological NF-
B inhibitors or mice harboring targeted deletions of elements of the IKK/NF-
B pathway (eg, 11–17). The results of the latter studies are conflicting, and the precise effects of selectively targeting the NF-
B pathway on HI brain injury remains to be determined. In our previous study of neonatal cerebral HI using 12-day-old rats, we explored the effect of inhibiting IKK/NF-
B by peripheral administration of a peptide inhibitor of the IKK complex, the NEMO Binding Domain (NBD)-peptide18 at 0, 6, and 12 hours after HI. This treatment schedule did not reduce HI-induced brain damage.19
The aim of the present study was to further explore the possible neuroprotective effect of IKK/NF-
B inhibition. In addition, we analyzed the contribution of IKK/NF-
B activity to cytokine production and regulation of apoptotic cell death to delineate the role of NF-
B in the pathophysiology of HI brain damage. To inhibit IKK/NF-
B, we used a modified NBD peptide, coupled to the protein transduction sequence of HIV-TAT (TAT-NBD), to facilitate cerebral uptake so that it can be administered intraperitoneally.20,21
| Materials and Methods |
|---|
|
|
|---|
TAT-NBD (YGRKKRRQRRRTALDWSWLQTE), mutant TAT-NBD (TAT-NBDmut; YGRKKRRQRRRTALDASALQTE) (W.M. Keck facility, Yale University, New Haven, Ct), or biotinylated TAT-NBD (PeptiTag biotin labeling kit, BioSight Ltd, Karmiel, Israel) was dissolved in DMSO (40 mg/mL), diluted in PBS, and administered i.p. at 20 mg/kg.19
Rats were terminated by 300 mg/kg pentobarbital and perfused with 4% paraformaldehyde in PBS or brains were snap frozen.
Histology
Coronal paraffin sections (8 µm) were cut
–3.30 mm from bregma and stained with hematoxylin-eosin. Both hemispheres were outlined on full section images and the ratio of ipsi- and contralateral areas was calculated.22
Deparaffinized sections were incubated with mouse-anti-MAP2 (Sigma-Aldrich), mouse-anti-MBP (Sternberger Monoclonals), or mouse-anti–ED-1-FITC (Serotec) followed by peroxidase-labeled secondary antibodies and revealed using Vectastain ABC kit (Vector) and diaminobenzamidine.
MAP2 loss was quantified as described above. MBP-staining was quantified using ImageJ software (http://rsb.info.nih.gov/ij/, 1997 to 2006).
Coronal frozen sections (10 µm) were acetone-treated and incubated with mouse-anti–NeuN and rabbit-anti–NF-
B p65 (Chemicon) followed by Alexa Fluor 488-goat–antimouse (Molecular Probes), biotin-goat-antirabbit (Vector) and extravidin-Cy3 conjugate (Sigma-Aldrich). Biotinylated TAT-NBD was revealed on 8 µm frozen sections with avidin-peroxidase (ABC kit Elite; Vector) and nickel-diaminobenzamidine.
Proteins
Mitochondrial, nuclear, and cytosolic fractions of each hemisphere were prepared as described.22 Proteins were separated by SDS-PAGE, transferred to Hybond-C membranes (Amersham) and revealed using goat-anti–β-actin, rabbit-anti-I
B
, mouse-antihistone-H1, donkey-anti–goat-peroxidase (Santa Cruz Biotechnology); mouse-anticytochrome oxidase (Molecular Probes); mouse-anticytochrome-c (BD Biosciences Pharmingen), rabbit-anticleaved caspase-3, mouse-anti-p53 (Cell Signaling); donkey-antirabbit-peroxidase (Amersham); goat-anti–mouse-peroxidase (Jackson Immunoresearch) followed by enhanced chemiluminescence (Amersham) and analyzed with a GS-700 Imaging Densitometer (Bio-Rad).
Electromobility shift asssays (EMSA) on nuclear extract with 32P labeled NF-
B probe was performed as described.19 Excess of cold DNA probe eliminated the signal, showing specificity of the EMSA.
Quantitative Real-Time RT-PCR
Total RNA was isolated with TRIzol (Invitrogen). cDNA was synthesized with SuperScript Reverse Transcriptase (Invitrogen). The PCR reaction was performed with iQ5 Real-Time PCR Detection System (Bio-Rad) using the following primers; IL-1β forward:CTCTGTGACTCGTGGGATGATG, reverse:CACTTGTTGGCTTATGTTCTGTCC; TNF-
forward:CCCAGACCCTCACACTCAGATCAT, reverse:GCAGCCTTGTCCCTTGAAGAGAA; IL-10 forward: CCTTACTGCAGGACTTTAAGGGTTA, reverse: TTTCTGGGCCATGGTTCTCT; IL-4 forward: GCAACAAGGAACACCACGGAGAAC, reverse: CTTCAAGCACGGAGGTACATCACG; IL-1RA forward: ATGGTGCCTATTGACTTTCG, reverse: TGTCTTCTTCTTTGTTCTTGTTC; GAPDH forward: CACGGCAAGTTCAACGGCACAG, reverse: GACTCCACGACATACTCAGCACCAG; β-actin forward: CACTATCGGCAATGAGCGGTTCC, reverse: CAGCACTGTGTTGGCATAGAGGTC. To confirm appropriate amplification, size of PCR products was verified on gel. Data were normalized for expression of β-actin and GAPDH.
Neuronal Cultures
SK-N-MC human neuronal cells (ATCC; Manassas, Va) were plated in 96-well plates in DMEM/ F12 (1:1) medium supplemented with 10% fetal calf serum, 2 mmol/L L-glutamine, 100U/mL penicillin, 100 µg/mL streptomycin, 0.5 µg/mL Fungizone, and 0.1 mmol/L nonessential amino acids (Gibco) for 48 hours before 24-hour incubation with 1 mmol/L NMDA (Sigma-Aldrich), 100 µmol/L H2O2, 250 nmol/L etoposide, or 100 nmol/L staurosporine (Sigma-Aldrich) and different concentrations of TAT-NBD or TAT-NBDmut peptide (10 to 100 µmol/L) for 6 hours. 0.5 mg/mL MTT (Sigma-Aldrich) was added for 4 hours. MTT crystals were dissolved in DMSO and absorbance was measured at 550 nm.
Statistical Analysis
Data are presented as mean and SEM and were analyzed by 1-way ANOVA with Bonferroni post tests.
| Results |
|---|
|
|
|---|
|
I.p. administration of TAT-NBD at 0 and 3 hours after HI had a significant neuroprotective effect; MAP2 loss at 48 hours was reduced from 79.3±1.6% in vehicle-treated animals to 34.6±12.1% in TAT-NBD-treated animals (P<0.01; Figure 1C). TAT-NBD treatment did not simply delay damage as the effect of treatment was even more pronounced at 6 weeks after HI when lesion size was reduced by >80% (P<0.001; Figure 1D). In fact, the size of the ipsilateral hemisphere of TAT-NBD-treated animals did not differ significantly from that of sham-control animals (Figure 1D). White matter loss as determined at 6 weeks after HI was also reduced by more than 80% (Figure 1E and 1F). The protective effect was specific for the NBD sequence because treatment with a mutated NBD peptide (TAT-NBDmut), which does not inhibit IKK,18 did not have any effect on cerebral damage (Figure 1C, 1D, and 1F).
Therapeutic Window
To determine the therapeutic window for the neuroprotective effect of TAT-NBD, we administered TAT-NBD i.p. as a single injection at various time points after HI. Significant neuroprotection was obtained with only a single i.p. administration of TAT-NBD immediately (0 hours) or 3 hours after the insult (Figure 1G). Importantly, the therapeutic window of peripheral administration of TAT-NBD was at least 6 hours. MAP2 loss was still significantly reduced by administration of TAT-NBD at 6 hours after HI (P<0.05; Figure 1G). Treatment at only 9 or 12 hours after HI did not have a significant neuroprotective effect (Figure 1G).
Intraperitoneal TAT-NBD Treatment Prevented Cerebral IKK/NF-
B Activation
Next we analyzed the effect of TAT-NBD on NF-
B activity in cerebral extracts by EMSA. I.p. administration of TAT-NBD directly after HI completely prevented the HI-induced increase in NF-
B activity at 3 hours after HI (P<0.001 versus vehicle). TAT-NBDmut did not inhibit NF-
B (Figure 2A).
|
NBD acts as an inhibitor of the IKK complex, thereby preventing phosphorylation of I
B
and subsequent degradation of this molecule.18 In line with this mechanism of action, treatment with TAT-NBD completely prevented the HI-induced decrease in cerebral I
B
at 3 hours after HI (Figure 2B).
The data in Figure 2C demonstrate that HI induces nuclear translocation of NF-
B in neurons and that nuclear translocation of NF-
B was completely blocked by i.p. treatment with TAT-NBD and not by treatment with TAT-NBDmut.
TAT-NBD Distributes to the Brain After i.p. Administration
To determine whether inhibition of cerebral NF-
B activity after i.p. TAT-NBD was associated with distribution of the peptide to the brain, we administered biotin-TAT-NBD i.p. at 0 and 3 hours after HI. At 1 hour after HI, clear biotin staining throughout the brain parenchyma was observed (Figure 3A and 3B). At 3 hours after HI, more intense biotin staining was detected throughout the entire brain and appeared to be intracellularly located (Figure 3C and 3D). At 12 hours after HI, we no longer detected biotin-TAT-NBD in the brain (Figure 3E and 3F). The staining was specific because no staining was detected in brains of animals that received unlabeled TAT-NBD (Figure 3G and 3H).
|
Effect of TAT-NBD on Cytokines
Inhibition of NF-
B activity may contribute to prevention of brain damage via inhibition of the cytokine response.10 A previous study in this model of HI brain damage suggested that increases in cytokine mRNA do not occur until 12 hours after HI.23 However, we already observed a HI-induced increase in the mRNA encoding the proinflammatory cytokines TNF-
and IL-1β at 3 hours after HI (Figure 4A and 4B) and the antiinflammatory cytokines IL-4 and IL-10 (Figure 4C and 4D). We could not detect changes in IL-1RA expression at this time point (Figure 4E). Interestingly, TAT-NBD treatment did not induce any changes in the HI-induced increase in cytokine expression, despite complete inhibition of NF-
B activity at this time point (Figures 4A through 4D and 2
A).
|
Effect of TAT-NBD on Proapoptotic Molecules
Kinetic analysis of the HI-induced increase in cytosolic cytochrome-c and cleaved (active) caspase-3 revealed that both were significantly increased starting at 6 hours after HI and further increased at 12 and 24 hours after HI (figure 5B and 5C). TAT-NBD treatment significantly prevented the HI-induced increase in cytosolic cytochrome-c and the increase in active caspase-3 determined at 24 hours after HI (Figure 5D and 5E; P<0.01 versus vehicle-treated).
|
Based on in vitro studies, it has been suggested that changes in expression and cellular localization of the tumor suppressor p53 contribute to initiation of apoptosis.24 Mitochondrial association of p53 was increased at 30 minutes after the insult and remained elevated up to 6 hours after HI (Figure 5F). TAT-NBD treatment almost completely prevented the HI-induced increase in mitochondrial association of p53 at 3 hours after HI, and TAT-NBDmut did not have any effect (Figure 5G; P<0.01 versus vehicle-treated). In addition, TAT-NBD treatment completely prevented the HI-induced increase in the levels of nuclear (P<0.01 versus vehicle-treated) and total cytosolic (P<0.05 versus vehicle-treated) p53 as determined at 3 hours after HI (Figure 5H and 5I).
TAT-NBD Protects Neuronal Cells In Vitro
To determine whether inhibition of NF-
B by TAT-NBD can have direct protective effects on neuronal cells, we treated SK-N-MC cells with NMDA, hydrogen peroxide (H2O2), etoposide, or staurosporine in the presence or absence of TAT-NBD or TAT-NBDmut. TAT-NBD but not TAT-NBDmut dose-dependently inhibited neuronal death in vitro in response to all stimuli used (Figure 6A through 6D; P<0.01 versus stimulated cells without TAT-NBD). In control cultures the addition of TAT-NBD or TAT-NBDmut alone had no effect on neuronal survival (data not shown).
|
| Discussion |
|---|
|
|
|---|
B pathway by i.p. administration of TAT-NBD early after the insult reduced HI-induced neuronal and white matter damage by more than 80%. Thus, inhibition of the formation of a functional IKK complex, which is a specific and critical step in NF-
B activation, might represent one of the most effective treatments for neonatal HI brain damage to date.
By using biotinylated TAT-NBD we demonstrated that after i.p. administration, the peptide was present in the brain at 1 hour after HI and was no longer detectable at 12 hours, indicating that in vivo delivery of TAT-NBD to the brain was rapid and transient. Comparable kinetics of cerebral delivery of TAT-fused peptides after i.p. administration have been described by Yin et al21 and Cai et al.25 We conclude that intraperitoneally administered TAT-NBD inhibited the IKK/NF-
B pathway in the brain after HI as we did no longer observe the HI-induced nuclear translocation of neuronal NF-
B (p65), the activation of cerebral NF-
B as determined by EMSA, or the decrease in cytosolic I
B. It should be noted that by using TAT-NBD only HI-induced activation of the IKK/NF-
B pathway was inhibited without inhibiting basal NF-
B activity, which might play a positive role in cell survival6 (Figure 2A; sham versus TAT-NBD).
In our previous study using NBD19 and not TAT-NBD, we did not observe neuroprotection by treatment with NBD at 0, 6, and 12 hours after HI. The most important difference with the present study is that we now administered the peptide at 0 and 3 hours after HI, suggesting that 0-, 6-, and 12-hour treatment may lead to adverse (aspecific) effects. In addition, we have preliminary evidence suggesting that prolonged (0, 6, and 12 hours) treatment with TAT-NBD may not be protective, because it may interfere with the HI-induced upregulation of antiapoptotic molecules like Bcl-2 at later time points.
Our data provide new insights into the pathophysiologic mechanisms involved in neonatal HI brain damage. First of all, it is commonly accepted that inhibition of proinflammatory cytokine production mediates the protective effect of inhibition of cerebral NF-
B activity in models of brain damage.10 Our data, however, do not support this concept as TAT-NBD treatment did not inhibit pro- (IL-1β and TNF-
) and antiinflammatory (IL-4, and IL-10) cytokine expression early after HI, although NF-
B activation was clearly inhibited (Figure 2A). These data suggest that HI-induced early production of pro- and antiinflammatory cytokines is not wholly dependent on cerebral NF-
B activity and suggest that HI-induced cytokine production in the brain can be maintained by other transcription factors, eg, AP-1. Moreover, despite the HI-induced upregulation of cytokines, we observed very strong neuroprotection, suggesting that early cytokine production is not detrimental in the context of cerebral NF-
B inhibition. It should be noted, however, that inhibition of cytokine production (eg, deletion of IL-18) or activity (eg, IL-1RA treatment) can at least partially protect against brain damage.26,27
Second, we show here for the first time the important role of HI-induced NF-
B activity in expression and localization of p53 in the neonatal brain in vivo. In vitro studies have provided evidence that increased mitochondrial p53 association occurs in conjunction with a rapid first episode of cell death independently of p53 target gene activation.28,29 Here we show that in vivo increased mitochondrial association of p53 occurred early after HI (0.5 to 6 hours). TAT-NBD treatment almost completely prevented mitochondrial translocation of p53. At the mitochondria, p53 is thought to inhibit the activity of antiapoptotic Bcl-2 members and to activate Bax leading to cytochrome-c release and apoptosis.30,31 In line with this model, we also show that HI-induced cytosolic translocation of cytochrome-c as well as the increase in active caspase-3 occur after the increase in mitochondrial p53 and are inhibited by TAT-NBD treatment. Finally, we demonstrated that the HI-induced increase in total p53 was prevented by TAT-NBD. Collectively, our data suggest that TAT-NBD treatment protects against neuronal death via preventing p53 upregulation and mitochondrial and nuclear localization, thereby inhibiting mitochondrial damage and preventing upregulation of proapoptotic p53 target genes, ultimately leading to reduced apoptosis-like cell death. Our in vitro study using a neuronal cell line further confirmed the hypothesis that inhibition of neuronal NF-
B activity can suffice to prevent neuronal death. However, we cannot exclude the possibility that other NF-
B–dependent pathways are ultimately responsible for the effect of TAT-NBD treatment on neuronal survival.
In exploring clinical applicability of specific NF-
B inhibitors like NBD to prevent cerebral damage, one should keep in mind that apoptosis-like cell death is known to play a more pronounced role in neonatal than in adult cerebral cell death.10,32,33 It might therefore be that the immature brain can benefit more from the protective effect of NF-
B inhibition than the adult brain. However, the neuroprotective effects observed by Herrmann et al13 in adult IKKβ–/– mice or after intracerebral administration of the IKK inhibitor BMS-34541 after MCAO suggest that the adult brain will also profit from NF-
B inhibition after cerebral HI.
In conclusion, we demonstrated that inhibition of the cerebral IKK/NF-
B pathway by i.p. administration of TAT-NBD has significant neuroprotective effects in a model of severe HI-induced neonatal brain injury. The therapeutic window for neuroprotective effects was at least 6 hours, and the neuroprotective effect was associated with inhibition of apoptosis-like neuronal death but did not involve abrogation of early cytokine expression. This finding sheds a novel light on the role of cytokines in cerebral damage and suggests that at least the early NF-
B–independent production of cytokines is not detrimental. The possibility that early cytokine production may contribute to neuroprotection or repair, eg, via TNF-R2 signaling,34 will be focus of future research.
| Acknowledgments |
|---|
Sources of Funding
This study was funded in part by the Wilhelmina Childrens Hospital Research Fund.
Disclosures
None.
Received September 11, 2007; revision received October 17, 2007; accepted November 22, 2007.
| References |
|---|
|
|
|---|
2. Perlman JM. Intervention strategies for neonatal hypoxic-ischemic cerebral injury. Clin Ther. 2006; 28: 1353–1365.[CrossRef][Medline] [Order article via Infotrieve]
3. Nichols TC. NF-kappaB and reperfusion injury. Drug News Perspect. 2004; 17: 99–104.[CrossRef][Medline] [Order article via Infotrieve]
4. Hayden MS, Ghosh S. Signaling to NF-kappaB. Genes Dev. 2004; 18: 2195–2224.
5. Moynagh PN. The NF-kappaB pathway. J Cell Sci. 2005; 118: 4589–4592.
6. Mattson MP, Calmandola S. NF-kappaB in neuronal plasticity and neurodegenerative disorders. J Clin Invest. 2001; 107: 247–254.[Medline] [Order article via Infotrieve]
7. Shishodia S, Aggarwal BB. Nuclear factor-kappaB activation: a question of life or death. J Biochem Mol Biol. 2002; 35: 28–40.[Medline] [Order article via Infotrieve]
8. Burstein E, Duckett CS. Dying for NF-kappaB? Control of cell death by transcriptional regulation of the apoptotic machinery. Curr Opin Cell Biol. 2003; 15: 732–737.[CrossRef][Medline] [Order article via Infotrieve]
9. Kucharczak J, Simmons MJ, Fan Y, Gelinas C. To be, or not to be: NF-kappaB is the answer–role of Rel/NF-kappaB in the regulation of apoptosis. Oncogene. 2003; 22: 8961–8982.[CrossRef][Medline] [Order article via Infotrieve]
10. Chang YC, Huang CC. Perinatal brain injury and regulation of transcription. Curr Opin Neurol. 2006; 19: 141–147.[Medline] [Order article via Infotrieve]
11. Schneider A, Martin-Villalba A, Weih F, Vogel J, Wirth T, Schwaninger M. NF-kappaB is activated and promotes cell death in focal cerebral ischemia. Nat Med. 1999; 5: 554–559.[CrossRef][Medline] [Order article via Infotrieve]
12. Duckworth EA, Butler T, Collier L, Collier S, Pennypacker KR. NF-kappaB protects neurons from ischemic injury after middle cerebral artery occlusion in mice. Brain Res. 2006; 1088: 167–175.[CrossRef][Medline] [Order article via Infotrieve]
13. Herrmann O, Baumann B, de Lorenzi R, Muhammad S, Zhang W, Kleesiek J, Malfertheiner M, Kohrmann M, Potrovita I, Maegele I, Beyer C, Burke JR, Hasan MT, Bujard H, Wirth T, Pasparakis M, Schwaninger M. IKK mediates ischemia-induced neuronal death. Nat Med. 2005; 11: 1322–1329.[CrossRef][Medline] [Order article via Infotrieve]
14. Nurmi A, Vartianen N, Pihlaja R, Goldsteins G, Yrjanheikki J, Koistinaho J. Pyrrolidine dithiocarbamate inhibits translocation of nuclear factor kappa-B in neurons and protects against brain ischaemia with a wide therapeutic time window. J Neurochem. 2004; 91: 755–765.[CrossRef][Medline] [Order article via Infotrieve]
15. Hill WD, Hess DC, Carroll JE, Wakade CG, Howard EF, Chen Q, Cheng C, Martin-Studdard A, Waller JL, Beswick RA. The NF-kappaB inhibitor diethyldithiocarbamate (DDTC) increases brain cell death in a transient middle cerebral artery occlusion model of ischemia. Brain Res Bull. 2001; 55: 375–386.[CrossRef][Medline] [Order article via Infotrieve]
16. Zhang W, Potrovita I, Tarabin V, Herrmann O, Beer V, Weih F, Schneider A, Schwaninger M. Neuronal activation of NF-kappaB contributes to cell death in cerebral ischemia. J Cereb Blood Flow Metab. 2005; 25: 30–40.[CrossRef][Medline] [Order article via Infotrieve]
17. Fridmacher V, Kaltschmidt B, Goudeau B, Ndiaye D, Rossi FM, Pfeiffer J, Kaltschmidt C, Israel A, Memet S. Forebrain-specific neuronal inhibition of nuclear factor-kappaB activity leads to loss of neuroprotection. J Neurosci. 2003; 23: 9403–9408.
18. May MJ, D'Acquisto F, Madge LA, Glockner J, Pober JS, Ghosh S. Selective inhibition of NF-kappaB activation by a peptide that blocks the interaction of NEMO with the IkappaB kinase complex. Science. 2000; 289: 1550–1554.
19. van den Tweel ER, Kavelaars A, Lombardi MS, Groenendaal F, May M, Heijnen CJ, van Bel F. Selective inhibition of nuclear factor-kappaB activation after hypoxia/ischemia in neonatal rats is not neuroprotective. Pediatr Res. 2006; 59: 232–236.[CrossRef][Medline] [Order article via Infotrieve]
20. Choi M, Rolle S, Wellner M, Cardoso MC, Scheidereit C, Luft FC, Kettritz R. Inhibition of NF-kappaB by a TAT-NEMO-binding domain peptide accelerates constitutive apoptosis and abrogates LPS-delayed neutrophil apoptosis. Blood. 2003; 102: 2259–2267.
21. Yin W, Cao G, Johnnides MJ, Signore AP, Luo Y, Hickey RW, Chen J. TAT-mediated delivery of Bcl-xL protein is neuroprotective against neonatal hypoxic-ischemic brain injury via inhibition of caspases and AIF. Neurobiol Dis. 2006; 21: 358–371.[CrossRef][Medline] [Order article via Infotrieve]
22. Nijboer CH, Groenendaal F, Kavelaars A, Hagberg HH, van Bel F, Heijnen CJ. Gender-specific neuroprotection by 2-iminobiotin after hypoxia-ischemia in the neonatal rat via a nitric oxide independent pathway. J Cereb Blood Flow Metab. 2007; 27: 282–292.[CrossRef][Medline] [Order article via Infotrieve]
23. Bona E, Andersson AL, Blomgren K, Gilland E, Puka-Sundvall M, Gustafson K, Hagberg H. Chemokine and inflammatory cell response to hypoxia-ischemia in immature rats. Pediatr Res. 1999; 45: 500–509.[Medline] [Order article via Infotrieve]
24. Culmsee C, Mattson MP. p53 in neuronal apoptosis. Biochem Biophys Res Commun. 2005; 331: 761–777.[CrossRef][Medline] [Order article via Infotrieve]
25. Cai S, Guang X, Becker-Hapak M, Ma M, Dowdy SF, McLeod HL. The kinetics and tissue distribution of protein transduction in mice. Eur J Pharm Sci. 2006; 27: 311–319.[CrossRef][Medline] [Order article via Infotrieve]
26. Hedtjarn M, Leverin AL, Eriksson K, Blomgren K, Mallard C, Hagberg H. Interleukin-18 involvement in hypoxic-ischemic brain injury. J Neurosci. 2002; 22: 5910–5919.
27. Mulcahy NJ, Ross J, Rothwell NJ, Loddick SA. Delayed administration of interleukin-1 receptor antagonist protects against transient cerebral ischaemia in the rat. Br J Pharmacol. 2003; 140: 471–476.[CrossRef][Medline] [Order article via Infotrieve]
28. Erster S, Moll UM. Stress-induced p53 runs a transcription-independent death program. Biochem Biophys Res Commun. 2005; 331: 843–850.[CrossRef][Medline] [Order article via Infotrieve]
29. Mihara M, Erster S, Zaika A, Petrenko O, Chittenden T, Pancoska P, Moll UM. p53 has a direct apoptogenic role at the mitochondria. Mol Cell. 2003; 11: 577–590.[CrossRef][Medline] [Order article via Infotrieve]
30. Endo H, Kamada H, Nito C, Nishi T, Chan PH. Mitochondrial translocation of p53 mediates release of cytochrome c and hippocampal CA1 neuronal death after transient global cerebral ischemia in rats. J Neurosci. 2006; 26: 7974–7983.
31. Chipuk JE, Kuwana T, Bouchier-Hayes L, Droin NM, Newmeyer DD, Schuler M, Green DR. Direct activation of Bax by p53 mediates mitochondrial membrane permeabilization and apoptosis. Science. 2004; 303: 1010–1014.
32. Northington FJ, Graham EM, Martin LJ. Apoptosis in perinatal hypoxic-ischemic brain injury: how important is it and should it be inhibited? Brain Res Brain Res Rev. 2005; 50: 244–257.[Medline] [Order article via Infotrieve]
33. Zhu C, Wang X, Xu F, Bahr BA, Shibata M, Uchiyama Y, Hagberg H, Blomgren K. The influence of age on apoptotic and other mechanisms of cell death after cerebral hypoxia-ischemia. Cell Death Differ. 2005; 12: 162–176.[CrossRef][Medline] [Order article via Infotrieve]
34. Marchetti L, Klein M, Schlett K, Pfizenmaier K, Eisel UL. Tumor necrosis factor (TNF)-mediated neuroprotection against glutamate-induced excitotoxicity is enhanced by N-methyl-D-aspartate receptor activation. Essential role of a TNF receptor 2-mediated phosphatidylinositol 3-kinase-dependent NF-kappa B pathway. J Biol Chem. 2004; 279: 32869–32881.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Stroke Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2008 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |